Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-h11   

Cenix:304-h11RNAiCenix:304-h11
PCR_productcenix:304-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF11H8.3 Source_evidenceePCR849WS150 Sequence/Annotation Release
Overlaps_Gene F11H8.2 Source_evidenceePCR3WS150 Sequence/Annotation Release
F11H8.3 Source_evidenceePCR910WS150 Sequence/Annotation Release
Chunk_score Abs_score847
Max_abs_score847F11H8.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII70195027020960
Overlaps_transcript F11H8.3 Source_evidenceePCR910WS150 Sequence/Annotation Release
F11H8.2 Source_evidenceePCR3WS150 Sequence/Annotation Release
WB_DNA_textTH:304-h111459tcattccatctaattgcacacaagttttattgaacaattcaagagtttaggccttgtagctacgtcctggacatggacagtatccagcgtctggtcctggttctcctgggcctccgtgctgaaataaattacaatgaaatttgaaatatgaaatatcataaacaaacctctccgcatgttccactctttcctggaattcctggtcttcctggaactcctggatgtccaactggtccttgatttccatcttctccagctcctcctggatttccttctggtcctggtggtccacggggtcctggtggtccggctcttccggcttgtcctggacgatactcagttcctggctctccgcgtggtcctggtggccctggacgtccagctgcccctggtcgaccggcgtctccctgctctcctggtcctccttgtcctcctgttggtcctggtggtccgtgtcttccttgatctccagctggtcctgctggtccgacaagtcctgatggtcctcgtggtcctggacgtcctggtgggcacttaatacatcctcctagaaattactcaatttaaaaacaagtctataacacagtaaagatacctggaatatcgtgagtaattgcaacaataactcctggtgcaccaggctttccatcatctccatcatgtcctggctctccactttgtccaccctctccaggtggccctggtggtcctgctgggcatccctcagactttggtccacagttacattgttctggataagcttgacgggccttacgtgttccgaaaagagtctcgaatgttggtggatgagattcgattgtttcttcgtcgacgccacctggataagtgtgttttgtgacgatcctttgccaggtgtctttagtaatggcgcggaattcaaacatctcgtcatcgaaatcagattgaagttgtttgatgtcagtaagaagacccatcatggtgtaaagtgccacgaagacacatacaagcatggaggcggaccccgcccagatgagtgtattactcattctgaaaattgatgcgatgtgtctcaaaatcatgcggaattaaaaataagttattttcttgaatcaccgtggcgggacccactttaaaatttcagtgggtctcgtaacgctcaaaccgattttagcggacttctcaaaataatagaataaaacagatgaagacgagttatacaaattatatatttctagataaatcaacaaataaataaaactaaaaaccaaaaattaactttctttgcgtgtatccaatggtttaagtagtcatccttatcagatcgtcacgtcctgaaccactcaataattttcaattttccgtttacttctccgaatggttccgcctgttttccgatcacttttcgacgacgtcaaaccagttagcatttctctgaaactctccagtaaccagtatctttgtctgttgctatcgaaca