Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-h8   

Cenix:304-h8RNAiCenix:304-h8
PCR_productcenix:304-h8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T26A5.6 Source_evidenceePCR1595WS150 Sequence/Annotation Release
Chunk_score Abs_score1429
Max_abs_score1429T26A5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64481636450400
Overlaps_transcript T26A5.6.1 Source_evidenceePCR1595WS150 Sequence/Annotation Release
T26A5.6.2 Source_evidenceePCR1491WS150 Sequence/Annotation Release
WB_DNA_textTH:304-h82238atggaacacaaacaaaacaaaggaaatatgacagaaattctaattacaataaaaaactttaaaagatgataaaatgcccattatacatatttgactttaataaatcactcagatggctcctctgcctcttcaacaccttcttgtgcggttgcttttcgattccaccagtttgagaattttgctttgactcgactaccggtttctcctgaaaacacgatcgagttaatcactttagtattaaaaatatttttttcgttttggcaaaatgtcagttttgtaaattttgaacattttgaataattcaaagcaatgaaagctatgccctcaattttttactgctacttcatttctcgaaattttttagatgctatattaatttccaaacccgaaaaaaattaccaatggtatttcctaaattctttccggcagtatttacagttccaataacttttgaagctccttcaactccatttacggcatgttcaaaacgaagatacacgtcatagactcccatttgttccgagaacatgtgcctgaaatattcagattgaaaaatgtattcatgttctgaaattcctcaccctggcgcaacagatgttaaatcttcatgtttgtttgcaacccaaattttgtgatttttagttctccgccattcgtttacaaaagcgattccaaaatgaggtatcgctgcttgtagatcggaacgtgacgtggcaacgaggccaagaagatagtttttcatttgtaaacgaatccattcatctgatccatcgaattcagcatttgaggatttaacctgttcttcgacttttttgagaataaaatcagcgaatcgaagatctgcagtagttagagaaactactcgttccaatgctgtgtcgttgacaaattcaatgtgattatggacaagagaaccgtcgtcttcgatctgaaattactcaagtttagttagaaacctgaaaattgttaatttaaaatacaaaccttcacaataacatcaaataaatcctttttcatcgcaaataaggcattcgtagctccaaatatacaactctgagtcttcgggactaaatccattgattgaattgatagatatggatcaaatgatgatccttgtgtgaataagcttataggaaatccacacgaatccttttctttcaatggatcatcatgtgaaagctgaacaccaacctcctcttctatcactatttcttcgctttttccttcagtttttgaatttacatttttgaaatgacaactcgtattgaccccgattgttgcgtagaacagaccttcttccaaaagctctgaaattcaaaattaaacgattttaaaatgtctgtatattcttacttggaaacattgaaacaatagccagcatagtttctcctaatcgtaatccagttggtgcaatgaataaaactttccgctctaataggaataatttaaaaagcagtagagctcggtgacggaatcgtataaaaagctcttgaattgatatttctgaaactgatatcgctaattaaaatgtgaacatttgaaactattttcatgttttattttagtaaattgattcaataacgtaccatgatgagctagatttgaaaagtattctccagtaagattttcgtcgaatatatcgcaaagattcgtatacatttgagcaagaacatcaactttcgaaaaatctttttgttcaaaatatgcctgagttattacttccaattttgcttttaatggaccaaaaagtggtattcttgaaagaacgcatacagctttttgaacactggtcctagtcacatcttccgatttatttattaattcctgcaaagtcaaacagtttttatctgaagagtcatataaaatctcacttttgcatcgatttgtctgtaacacgagatgccaaatatcgattttccaggttcttctctagatggaagcaaaaagaatattgtatctttttgacaattatgtacaccatccggcaacgccagtgatggaagaagatgccattcatcgggtaatcccgattcgcccgtgccatcgagtttcgggtgcgagtattctacctacaagatttattttattgattttttacaaattgagttgatgaacttgaatttaaatcttcactccatataatacaaaacttaataattaaatgtatatgaaaaatactgcaaaaatagtaaaaagtaccaaaaacgttctgctttttgtgaaatgttcgattgactg