Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:305-e9   

Cenix:305-e9RNAiCenix:305-e9
PCR_productcenix:305-e9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F44B9.7 Source_evidenceePCR181WS150 Sequence/Annotation Release
F44B9.8 Source_evidenceePCR950WS150 Sequence/Annotation Release
Overlaps_Gene F44B9.7 Source_evidenceePCR186WS150 Sequence/Annotation Release
Chunk_score Abs_score165
Specificity_index0.134
Rel_score0.155
Map_statusBottom50_percentile_ePCRIII80277038029301
F44B9.8 Source_evidenceePCR1130WS150 Sequence/Annotation Release
Chunk_score Abs_score1067
Max_abs_score1067F44B9.8
Specificity_index0.866
Rel_score1
Map_statusBest_ePCRIII80277038029301
Overlaps_transcript F44B9.8 Source_evidenceePCR1130WS150 Sequence/Annotation Release
F44B9.7 Source_evidenceePCR186WS150 Sequence/Annotation Release
WB_DNA_textTH:305-e91599aatatcaaaattgcagctgttgggtgaaattccacaagaggaattatttttgcatgatatttccagctaaagcctcactttgaattcccataaacggtggtggaccgcctggaggccccggttgaggatattgaggagactgtggaatgtatggcatcggcattccagcttgatacattggataatatggtgtaggtggaaatggtggaggttgatttgggttgccaggcgggtaatttgggggttgattcggattcattggtgctgaagttttggaatttcataattgttccgtttctgattctgatattgagagagcgataacttactccacagtaaaattaaaatgtagtaatcaagttgcaaccagtttattggatattcatacatgtaagtgtaaagtcaactttttcacagatcgaggataataaatgaggtcacttaaaaaatataaaaatatactgagagatcaaacaatttactcatttcgtgaaaaataggaatcaccgagacagccaaaggagaatagaatactcttaaaattccatgtcttcaatttccaagttcttcatctctttcacacacaaacgttttgcctcgaaaaaagctgcaacaacagctgcaagctgtgtttcattagaacatccagttgacaaattctcctcaacttctcctaatccagtgataatagctgacattgcttcatctgggatgtccaaagtgaatacaaaatcgtggagatgagtgatgacatcttgaagggcatatccgttctcgaacaatttcgtttgaattgtattcatacattttttcgatggatcattcagtagagtcttcacaacttctttcatttctttcggtgtcggctgtccaatacactggtaaactgtattttctgaaactgtatcgaaactcattgcagtactttgaagtgtgttgatgacagttctcatgtcaccttttgaaacaatcaaaagtgcatcttttccatctggagtcattttcagttgttccgtctccacaatgtattccaaccggggaacaatcagtttttgatctaagggagcgaatcggaaacgagtacaacgggattgaatagctggaacgattgatgccaagtagttgcagatgatgcagaaacgaacgttgtccgtgtacttttcaatcactctgaaataaatatttacattgtggatgattatattttgttcataatcagttttatctaaccttctcaatgcattctgagcatcctttgtcatagcatcagcctcgtcaagaatcacaagcttaaacggcacagtgcctgtgttggaagatgtcgaaaatgcttgaagtccttttgtttgtgcgaagtttacgatggtgtttctgaaaattgctataaatttaaaaacgcctgatcaatagtttatctatttacctcacaacatcaattccacgttcatctgaagcgttcaattccaataccattgacgccattttcgtcggggaatacatttgtcgcgctgctgctaacaccgtcgtcgtttttccagttccaggtggtccgtagaaaagaagatgaggcaatgtgcggttttcaataaatttcgtcac