Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:305-h4   

Cenix:305-h4RNAiCenix:305-h4
PCR_productcenix:305-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20B12.8 Source_evidenceePCR1883WS150 Sequence/Annotation Release
Overlaps_Gene T20B12.8 Source_evidenceePCR1883WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII73794127381572
C32F10.5 Chunk_score (3)
Overlaps_transcriptT20B12.8 Source_evidenceePCR1883WS150 Sequence/Annotation Release
WB_DNA_textTH:305-h42161gatggtggtccattctttctgtattccttcatttctttctcgtatcgagacttatcttcttctgctttttcctcccatttctgtaaattaaaattattttagaggataaattgtagactataatcaacgaacctttttatcatccgagctcatcgttttccatttggctccacctttcttggccacatcagcaacagaatcaccatcctccttcagttcatttcgactagcaaggaaccattgcatgtaggcacttgtagcacgtttcggagcgtttggatctttgtctttctttcctttcttgccttccttcttttctcttttctccttcttttccctcttctctttaggttcaccctttcttcgcttcgacggaacatcttgctcagaatccggctcagactctccagttccactggaatcttgttctgatccagaatcatattcatcgtctggctctgatccagttccttctgacgactccttatcctcctttttcttttttatatccttatcaagatcataatcttcatcagtactgtcatcatcactatcatctcgttggcgtccttcggctgtaactgctgctttatatggatcaatttcatcatcactggagtctgcgacggtattctcgacacgttgtgaatttcggattttgatatttttcttattcaaataatcgaataatttgttgttctcctccttttccatcgcattgaaagttaaaggtcctccatatttcaaatcaatctcgaaatcaaatgtcctggtgacagtaccactatcagaacgtgcaaaatgacatgagctaatctcctcaaagcgaatgtacatggctggcttgtgaatgaacaaaaatcctttttccattgggtacaataatccagggttctgacgatgtgtacattgaatggcaggggtgcccgagcttcccaggaaccgtccaggaacagtgatttttaaattgcaaattgatttgaagagaattgagattgtttcatagattggaccagtcatgtcacgtcgtagattcccattgctagattcgagttgttcactaaaaatataatatttttagacgattgtccgatttttcgtaaaatctctagataaactcactcagtaagtgccaactccaaatcttgttcctcgtcttttccaaactcaaaaatgagataactgtatcgtgtctgtccctgacggattggtggattcaacgacaacacaaaatatacatgacgtccatctttatgaggtaccaggaatagacgattgatcgacttgataggaatcttgtagtcgtacgtttttccatgaagtgcaatacttgttggataaactttgatgtcgtatcttccacgaggagttgtgcatagaatgtcggtgagaagacatatcggttgctccgtctcggcttccaatccagcgtatgccagaacagctttcttgaattcttcaactttatcagcatcctcctcattttcaagatcaattggcatatggaatctcatctccatgagctgaactttgctatcatcattttggtggaactccaaaactgcctcatttttgtttgcaataacattcgatacattcgtgcacgggatttcgaaaattggcttatcttcccatgaaaattcaacagtcttgccttttacttcggcttgtccgtagttccatcctttgatgaaaagatttgattgatcgatggattgagaccaattagaagaagtgaacgattggattttctcgaggtcctgaaatttcaagtttgtgattgaagttttttgaaaagcagcaagaaagcaagagtgttttaaatgaaactaaaaacaaatcaaaatgaaatgaacaaaaaactaacagtatctttgaatcctccgaagcggtgagcacctccatcgttgagaccgactcgtagtcccggcttgttgccaagtttttgccatttcagtttatcgatatcggatcccgtgacattaactgattttccacccttatcgcctttgaagttgagtgatttttcagtcaatttaagtgttccgaacgccaaatgacctacatcttcaacataaactcccgggaattggagctcagccattctgaaaattgtttgtcaataagtctagttaacgagagagagagggaagaaatcgaa