Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:308-h4   

Cenix:308-h4RNAiCenix:308-h4
PCR_productcenix:308-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0285.3 Source_evidenceePCR501WS150 Sequence/Annotation Release
Overlaps_Gene B0285.3 Source_evidenceePCR535WS150 Sequence/Annotation Release
Chunk_score Abs_score430
Max_abs_score430B0285.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII43411994343259
Overlaps_transcriptB0285.3 Source_evidenceePCR535WS150 Sequence/Annotation Release
WB_DNA_textTH:308-h42061caaatgctgagtattccttccacgcaagcggcaaaacgcctgcctgcgtgcctatatccgccgcaacttgcctgattttttgactgcctcgttctgactcattattttctgtaatatgaagtaggcgtaaggcccgtcctgtaggcacggaggcaggcatctttgtgccttctcagaggagctggaaagtcgaattctgaattttatttcaatcccaagtcgaccatggagttagatgtgcaaatttcgaaagactgctccctgcaacttctaggcgaattctgacactttaaaaaaaaatttttgaatgtaaattgaaagatcaagcaacagtaattagacattttcttagagctagactatataaaactataaataaaaattttcaagtatattttattagaaaaacgtattttgatccactttctgtaatattttatcaacttgattgcctccgactctttctcgggagaaatattcattttttccctcttattcagaataaaattactggtatttattttcctttccctcgccttgattgtacttttttctttcaaatttaactctgaattaaagcattttccaaaattttccacgatttttaaatgttgccggtcttttcccctttcctcatcatcattgtcaatttatatagtttttttgttgacatttttcatgttccaatcatactttcctggttaattctgtgattttttaaaacttttctaaaaaagaagaagaaatttgtaattaaattatattttctttattgacttagtatttcaatttttcacaacttttaaagataatacaactttttcagacttttttgaagatctttatgaattcaggctgttgtttcctctgcactagaaggcgatggactaggatcagtgactttctgaaataatgttaaatttcagaatctttaaatggagaataaatgttaaaacctctgtaatcgcgactccatattcttgttcgtattccttttcgagcgcatcccacggattattccacatggaagggattatacatttgttcgcgtcaattgggccctgtaatttattattttgagtttagacactctcggcaaaagtacggtagcgggtctcgacacgacaaaattttgttgactgcaaaaaggtgtgcgcctttaaagagtactgtaatttctaactttcgttgcgttcgccaaaaactatgaaaagtagatgaaaagtccgcagaaacaaaaatttgaaattacagtactctttaaaggcgcacacctttttgaatttaagcaagtttcgagaccggaaaccgcatttttattgcgcttatattctaaaaattactcgaaactgcaataaaaccgaataaattgtattttttcgaggaaaaatctaaaataaccgccgataattgggcattaactaaattattccgtacttctttgtttttttttatttatttttttttagcatattgagtgctcttggagaaaccttaacccaggtgccatgtttattgattatttaagtctttaaaaatttaaagaagccttacaaaattcttgttgcctccacctccgccacctcttcctctatcaaatcctccccgtccccttcctcggtttccatagttgttctgattccctccacctccaccaccaccgccacgataatttcctctgaaatttcctcgatttgcttgatacggcgacgcaaagttcagatttccatcgtctctgaaattactccatccaccatcgttggagcttccaccacgatatcctcctcgattatcgttacctttccatccaccaccacctcttcctcgtccttgtggtctccaattattgtctgaaattataaaaataatcaaaatatcgttttaacagttatttcattgttttaaattgtataacttacttccccgtggttgccattgaccgccgccattattcccgtagttcattccacagatttaattatatgtacttagtacttatcttaaattctgctggaaacaaaaaaaaaacggcaaaacaaatccgataactttgaaatcggt