Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:31-b7   

Cenix:31-b7RNAiCenix:31-b7
PCR_productcenix:31-b7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C32F10.4 Source_evidenceePCR994WS150 Sequence/Annotation Release
Chunk_score Abs_score868
Max_abs_score868C32F10.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58084535810076
Overlaps_transcript C32F10.4.2 Source_evidenceePCR958WS150 Sequence/Annotation Release
C32F10.4.1 Source_evidenceePCR994WS150 Sequence/Annotation Release
WB_DNA_textTH:31-b71624cacaaccacgagcaaatgtcaaaatatacatagaagacagagtgaaatctattgaagaacgtcacttcggactgttatatgtcctggttcaaccacgtcactatatgcaggcggccgagaagttgcacgtggtcgggttggatcttcatcatttgtaaacgccgaattgtcagctcctgttggttcactctgaaattgttacagagttttagtgatgtcatagggaaagaattttagagctcattctggctcgaatttgctggaaatcggaggtttcccaataataaccatttttctgatattagtattactttttcgactacaagcgctccgtaacaaaatttagcgggttatttgaagttaattataatcgcattaagacgtatttatctaatgcagcttataatatagaaagaatagcttagttttatattattgattaatgaatagtcgttgaaacggatttcataaagcttcaaaaaattttcaaaactcacattggcaactgtcaaaatcggtgtcgatacgaaagaaccactcctcgttgatgccgacgtcgtcgaactctcgctatcaacaggttgttgttttgtaggaatcggaggagcagtttgacttgacattggtggggcgtaggcggtatatcttggtggtggtggcataccactgggactcattggtgttggtacaatgtattgaacattgtaatttgacgcctgatgttgaggtctgaaccattgaatgaatattcataattgaaataatggactcacaatctgtatgcatttcttctgaggaagttgtagagaatcatcatatatcgcatttggacgagtgcaacaataatactaacagttaggaagaaacatgagattataaccatttctaattctccagttgtcatttttggaacacatcccttcgcagtggttacatccttttggttatcttcaaatcagtttctttattccggaaaattgtattgaaactaacctggattgcaaatgttatcattgttatccgataaataaatacatgcaataactgctcccaggatcaagaaaaacacccaaaatgtgtacattgactgaaattgataattatttctcaaagtgtatattaacgagaatattgatgcttccataattgactaggaacatcgaatcttgtgagttatatttaaaacgtactagatataacatgtaagcagtgatataggcaatttttctacgctttgcaccagttgatagaacaaacatcatggcgcttccaatagaaatctcgaaaacgtagagcacaaatggagatggatacaaaagtccgaatatttgacatatcatgagaatggatccgagaattccaacagctccctgaaaaatgttcaatccttgctgagattcaaaatttctgaacttacaccaattggaagtccacaaaatacccttggctccggttcagcagctatccgctgtgttggctgatgtggttcagcccgttgttgcgggtgctgatacggatccgtcgtttgagaagactcggttgtcatggttcttctggaatcaatacaattttcttggcttatatggtttataaatgcatttgtgtgtgtctgagtgtgccaaca