Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:310-b9   

Cenix:310-b9RNAiCenix:310-b9
PCR_productcenix:310-b9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK10D2.7 Source_evidenceePCR255WS150 Sequence/Annotation Release
Overlaps_Gene K10D2.1 Source_evidenceePCR99WS150 Sequence/Annotation Release
Chunk_score Abs_score78
Specificity_index0.244
Rel_score0.52
Map_statusBottom50_percentile_ePCRIII51958875196735
K10D2.6 Source_evidenceePCR92WS150 Sequence/Annotation Release
Chunk_score Abs_score92
Specificity_index0.287
Rel_score0.613
Map_statusBottom50_percentile_ePCRIII51958875196735
K10D2.7 Source_evidenceePCR255WS150 Sequence/Annotation Release
Chunk_score Abs_score150
Max_abs_score150K10D2.7
Specificity_index0.469
Rel_score1
Map_statusBest_ePCRIII51958875196735
Overlaps_transcript K10D2.7 Source_evidenceePCR255WS150 Sequence/Annotation Release
K10D2.1a Source_evidenceePCR99WS150 Sequence/Annotation Release
K10D2.6.1 Source_evidenceePCR92WS150 Sequence/Annotation Release
WB_DNA_textTH:310-b9849tgttctccctttgcctcatcaatttactggtatagctgttacaatttattgatttttttctttgaattctaactacaatttacactgaattatcgatatgaaattttttactttaaaattgtgaacttcagcatgatttcaattaaagtgttatttttcggagaagcatgtcagctggtcggaaaaagagaagaagcggtgggcttttattattagacggaaacaatttggataattttgaacttttagattgattttcccgaagagaccgattatgaagagattcggaaaacaattttagaagtaataatttacagatttcaaattaaaaaattgaatatttcagaattacccagctcttcaaaaaattgaaaaggttatgatgctcgcagtggatcaggagtgagttttcagaaaattgaggtgcaaccgcgctctacggccaaatggaaaagctccgcccccaaaagttaggtctcgttaggtattggcagcaaaactgttaattgaaatgttttcaatagcttttcatcatttttgttatgtttcgcgttgtttttaaagaaagctttcggaagtgtcgttgccaatacctaacgagacccaacttttggccgtcgcacatctctgcgtctttataatatgtcgtttacagatatgccaaccccggagatcgtttcgaattggttcgcttcacagaaatcgctgtaattcctccattgtctggtggataatcttattgtgataattcttgtagactctgtttatttcaatgaaaatttgtgatatatttgacaaaaaaaaactagaaaagtgggttagtgggcgacaaagggtgcaaaataggga