Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:310-e4   

Cenix:310-e4RNAiCenix:310-e4
PCR_productcenix:310-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K12H4.4 (3)
K12H4.5 Source_evidenceePCR6WS150 Sequence/Annotation Release
Overlaps_transcript (3)
WB_DNA_textTH:310-e4781acgcactcctagcgttcactctttgggtgatggccgcagtcacagcagcttgtttcctgtcaacagttttcctcgactacactgttccaaccaagctcactgtcaacgatgtcaaagtgtaggttttataagagaaataaaaaaattgcgaaattctttcaagcgtttctccgaaaacattttaaacgtatttctgtaaatcttattccattttcaggagaaacgttgtcgactacgccacggatgagcaacaagccgatctcgccacactaaacttcaatctgaaagtcgatttttcaaagattttcaactggaacgtcaagcaattgtttgtttatttggttgcagaatataaatcgaaagtcaacgtaagctttggaaacttttattgaggatcgaaaaaaacttctttttttttgcaattgtaggaggttaaccaagtggtgctatgggacagaattgtggaacgtgctgaccgtgtggttatggacgagatcggtgtcaagtcaaagtattatttcctcgacgatggaaccaatttgcttaaccacaaaaatgtcacctttgttttgaggtttgaattgaaaattcgataaataaaaccaaatattaaaatatttagatacaacgtgattccaaactctggctatcttcgtcttgttcaatcttccgatcaagttgttgttccgttcccaaccacatacacaactactcgaagatcctagttacatcttattttacttgtttcatatgaaatactatgggttatgtgtttcatccg