Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:312-a2   

Cenix:312-a2RNAiCenix:312-a2
PCR_productcenix:312-a2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene R13A5.8 Source_evidenceePCR628WS150 Sequence/Annotation Release
Chunk_score Abs_score565
Max_abs_score565R13A5.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII75719717572823
Overlaps_transcript R13A5.8.1 Source_evidenceePCR628WS150 Sequence/Annotation Release
R13A5.8.2 Source_evidenceePCR624WS150 Sequence/Annotation Release
WB_DNA_textTH:312-a2853cattagcacctttgaccagattcgttgttcgctaattcaaataaaaacttcagattttgataacaaattcattaacaaaaagcgactagaaattagtcagttgggacgatggtggtcttctccgaaacgtagattccgtcgaggaatttacggatatccttctccttaacggcggtggattgttggatacgggcagctgcagaaataataatttaaatgtgaaataaacaaaataagttttcttaccggcttgagatacgaattggacatcatttccctcgactacgatctcgtccttttgggcggtggagatggtggcgatgactccctctggaagtgggacacgacgaacgatcttctctcccaagaagttacggatctgaataatgtgtgagtttgaattatgaaacacatgaataatttcacttacctcaacagttctgtttccatcttgaagggtaacgttgatggggaaatgggcatatacggaacgcatcttgtagcggaatccgacggtgactcccttgatcatgttcttgatgtgggagcagacagtgcggatagcggcaagctccttacgaactccgaaccacttgcggacgcggagggtgctctttccgatacgctccatctccatgtgcaagtgacggaaatccttgcggatggttccgcgtggtccggtgacatggacgatgcggttcttgacggtgaaggtgactccctctgggaacacaacagtgtcgttagactcgatcagcttcatgatctccctggattacctggaaacgataaaatgaattgcaacgcattaaaagtaaatatcaagaattaaaaatcaacagagttcggttca