Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:313-h1   

Cenix:313-h1RNAiCenix:313-h1
PCR_productcenix:313-h1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC03B8.1 Source_evidenceePCR189WS150 Sequence/Annotation Release
Overlaps_Gene C03B8.1 Source_evidenceePCR189WS150 Sequence/Annotation Release
Chunk_score Abs_score126
Max_abs_score126C03B8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII77166397717343
Overlaps_transcriptC03B8.1 Source_evidenceePCR189WS150 Sequence/Annotation Release
WB_DNA_textTH:313-h1705tgcgtaccgagagagtagcaatgtttcagtatcttctcggtgtacaacggcatgtcaatgcttgcctctgcagctgttgccaacatcatctgcaacctgttcctccaactgcctgctgacagaattaatgatgttcttgggttcaagtaattatttctgcagttgttgacctacagtaacctttttcagaaagccagtactttctgtagatcaaatgaatattcccgaatatcaatacgctgcgtttggagccaaggtgagtatggatcgagtagtcatgcaaaaaaggaaaagttaattattcgatcgggtgacgtcacatatttgtttccagaggaactacattgaaaaatggttgtgacgtcacgcttcccttaaaccggagattgccacgccttcaaataagacacccttaattctctttttcagttgagtggattatggatggggttaacacttggaatgttgccattattcttcatcgatgacaatttagacaatcgggcttctgataatggagatttattagtatctgtggctaatacgaacggagatgaatattgtgaactgttttgtggtgattaaatggttttgatctcttcttgctataattatatttatttcaaaaatcacgaacttgttgccttgtttttcgaaaatctgcaagtgccacacggtcctatgggcgtggccaattcatctaat