Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:314-e3   

Cenix:314-e3RNAiCenix:314-e3
PCR_productcenix:314-e3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20H4.3b Source_evidenceePCR1208WS150 Sequence/Annotation Release
Overlaps_Gene T20H4.3 Source_evidenceePCR1486WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII72392297240922
Overlaps_transcript T20H4.3a.1 Source_evidenceePCR1486WS150 Sequence/Annotation Release
T20H4.3b Source_evidenceePCR1376WS150 Sequence/Annotation Release
T20H4.3a.2 Source_evidenceePCR1486WS150 Sequence/Annotation Release
WB_DNA_textTH:314-e31694agtacgcagctccaaatgctcgtcaatccaaaccaaagaaggaagagaaaccaaaacaacagccaaagcaacaagaaaagaaacaagatggaaagaagcagacattgttaggagttggaaccaagaaagatgataactattcggaatggtacagtgaagttatcactaaggcagaaatgatcgaatactatgatgtatctggttgctatgttcttagaccatggtcatttgcagtttgggaatctattcaagaatggtttgattctggaattaagaaattaggagtgaagaactgctacttcccaatgttcgtatcaaatgctgccctcgaacgcgaaaagactcatattgctgattttgccccagaagttgcttgggttactcgtgctggaaactctgaaatggccgaaccaatcgctattcgcccaacttcagagacagttatgtacccatcttacaagaaatgggttcaatctcatcgcgatcttccaatcaagttgaaccaatggtgcaatgttgttgtaagtattgattttttaattgaaattagttaaaaatttttataaatttctgttgaatttctcctagctgtcttgctccactgcaaaaatattatcataatacttttttcctttacagcgatgggagttcaagcatccaacaccattccttcgtactcgtgaatttctctggcaagagggacatacggcttttgccaacccagcagacgctgaaaaagaggttttccaaatccttgatctctacgcaggagtctacactgatttgctcgctatcccagttgtgaagggacgaaagagtgagaaggaaaagtttgctggaggagattttacgacgacagtcgaagcatacgtggcatgcaatggtagaggaatccaaggagcaacttctcaccatctcggacaaaatttctccaagatgtttgatatttcgtacgaggatccagcgaaggaaggagaacgagcattcgcttggcaaaattcgtggggtctttccactcgtaccattggtgcaatggtaatgattcacggagatgacaagggattagtacttccaccaagagttgccgctgttcaagttattgttgttccagttggattcaagactgagaacaagcaatcgcttttcgatgctgttgataaggttaccaaggatttggtcgcggatggagtaaaggctgagcacgatttgaggtttgaaattaataatgaatgcagttatgtacgtttttaattacagagaaaactacaatgctggctggaagttcaatcattgggaattgaaaggagtcccaatccgttttgaggtcggaccaaatgatttggcaaagaaccaggtaaccgctgtaatccgtcacaacggagagaagaaacaactttccctggaaggactgtctaaaactgtcaaatctcttcttgatgaaattcatactgctatgtacaataagttggttaaaatttttaaaagttgaaataaattccatacttcagggtactcgctcaacgtgactctcacctgaagagcaccacgtgcatcgaagaattcaagaagcttcttgacgagaagtgcattatactgtccccattctgtggtcgtccagactgtgaagaggaaatcaagaaggcatcaacaagagaagacggagaaggcgcacagatgggagccaagacgttatg