Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:314-g1   

Cenix:314-g1RNAiCenix:314-g1
PCR_productcenix:314-g1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04A8.14 Source_evidenceePCR1480WS150 Sequence/Annotation Release
Overlaps_Gene T04A8.14 Source_evidenceePCR1480WS150 Sequence/Annotation Release
Chunk_score Abs_score1396
Max_abs_score1396T04A8.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII47179034719526
Overlaps_transcriptT04A8.14 Source_evidenceePCR1480WS150 Sequence/Annotation Release
WB_DNA_textTH:314-g11624aacaaatccattgactcggccttccttagtccattgtttccaccgccaaacgttcgtttcgtgaaatgaaccattcgaagataatcaacaattgcaccattttcatcaaccattacaccaaatgaagcttcgtctcgctctgttggatagcacactgccatgattcgacgagctccatgttgatccataccatcatcatcgtcatcgttattatcgaaatccggctgaaataaaacaaaacaattacatagttattaaatcaaattaataccagatatcctgatctagaaattcgagatgcaaactcctttctacatttctttgctactgcagtctttgcttcttcaagaatcgtattatacaactcatccctcatgtagggtacaagcatttcagttatagccatattcacacactcatctctcactgaattccattgttcaacattttccgtgtattcgtctttttggaaaatggaatcacttagatacttgttaacgaggtagttatttgaatcctgatcttcttcagattcatacatgatgagcacatcaacaagaccatcctctttggctttgtgatagaagaggaactcttcagcggtgagacttcgaactggtttactctaaaaatatatatttattaaaatcctagacatttatttcaaataattctcaccttgatataccgtttgtcatagaggggatgagtttgatcaattgtatcacgtcctttcttcgttggcttgatccaaaaatgtgcagactggcggaattcttgccgaacactatgcctgacttgtggttgtcgactgatctccttggcaagcatgaatttcgcaccattcagaaccatatcactgtcactgaacgcaggacaaacatactcttctgctgcttccaatggtaacatcggatcttgctcaatgtcgtgttttttccagttcaaattttcagaaaactgttttgcagtcaatccaaaccgtccagcaagctctccgattccgttttccacacacatttgatacttatcattacgaatgcttgacttgaacttgactcgatactcttgttcctcttcttcaccggttaaacgtcctttttcccatctaatcatatcgtcgagaagagcaccgtacaacaattggaaatttgcatgtatgtcggtaagctgttcaagagtttctgcgtattttgtgctgaaaaataatttaaattctaaattttaaattttaaaacttactccatcaaatctgcatccgaaatcggtcgtctttttgcggtcaaatcgtcactgagttcctgatactctctcatccgacgcattaaatcgtaaattttatttttcttctctgacaaatgacaccatttttcgtcaaaatcgtatactctccatagattattcattgtcagaagattgtcaatatcttctttacgataaaatccaataaacgtaggttcgaacgaattagaacgaactcgaatgaattggagaactttcttgatggattttataacagctttctttctatcttcatagacagaaggatccagattcattatacaatcaagtttatcgtcttgatccaggtcagcttgatttgtcactgtcccttcttcgaagg