Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:32-a11   

Cenix:32-a11RNAiCenix:32-a11
PCR_productcenix:32-a11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39H2.2a Source_evidenceePCR787WS150 Sequence/Annotation Release
Overlaps_Gene F39H2.2 Source_evidenceePCR787WS150 Sequence/Annotation Release
Chunk_score Abs_score661
Max_abs_score661F39H2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86497738651258
Overlaps_transcript F39H2.2b.2 Source_evidenceePCR787WS150 Sequence/Annotation Release
F39H2.2a Source_evidenceePCR787WS150 Sequence/Annotation Release
F39H2.2b.1 Source_evidenceePCR787WS150 Sequence/Annotation Release
WB_DNA_textTH:32-a111486gacgatacttcgaacgggaagatcttccaaaaatgcgtcacactcgtatgggaattgtttcatttgtgaacaatggagataatatgctcggaagtcaattctttattacacttggagagaatcttgactatttggatgatcaacacactatttttggacaagttactgaaggtcttgaaacactggagaagctcaatgaacagttagcagacactaacaatcgaccgtttaaggatattcggtgagtttgtaacttcgttgtttctagaaaaccagggctgaggataaacacctcatgaaaatgaaaaacgaaaatcgcaaaaacaaataattttgctattaaaatgagtttgtagcattttcttggtattcttttaaattctcagtttactcgtactctatttatattctcgagtgtcattttttgaaaaaacgaggtgtaaaatttgaaaaatgtatgatttttcaggtaaggaaagggcaacaaagtttttagattttttggtcaccttttctcagaaaaatcaaaaattgatttttcgccaaaaaatgaaaacccccaactttggtacaaataactaaatataaatttccacaaatatttttcagtaaccaagctgaagattaatttttatgaaactacagtaatcctaccgtactcccaccattaaccccaactcagaaatcaaaacttcagagtgtatagactagaacacacggaacaagcgattttgatatattaaatgattttcagaatctcacacacaattgttcttgacgatccattcgatgaagatgctagaatttcttttccaccacgatctccatctcctacttatgagatgcttgtaaaggtttagaaaaatactaaattaataattattaaaactttttaatttctcagactgatcaaattgctctcgatgaaaaagaagacgaagacgagggaaaaactgcagaagagattgctgaagagctgcaacaaagagaaatggctgaacaagctcaaattcttgaaatggtaaaaaacatttataagtctaaaaaataattatttttcacaggtcggagacttgaaagatgctgatgaagttccaccggaaaatgtgttgtttgtttgcaaattgaatccagttacaaccgatgaagatctcgagattattttctctcgattcggaaaaattaacaactgcgaggtgatagttttgttggaaaacatttctttacgaaaaacatgatttcagattgttcgagaccgtcgcagtggtgattctcttcaatacgcgttcattgagtttgacaatgcgaaaagctgtgagcaagctttctttaaaatggacaatgttcttattgatgatcgacgaattcatgttgatttctcacaatctgtctctcaaaattacaagtacaagcccagtaagttctgaccagcttttctgaaaattcagcttcaattttcagaatcacagcaacaagaagcaccaaa