Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:320-a8   

Cenix:320-a8RNAiCenix:320-a8
PCR_productcenix:320-a8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53A2.4 Source_evidenceePCR809WS150 Sequence/Annotation Release
Overlaps_Gene F53A2.4 Source_evidenceePCR812WS150 Sequence/Annotation Release
Chunk_score Abs_score770
Max_abs_score770F53A2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1334079213341901
Overlaps_transcriptF53A2.4 Source_evidenceePCR812WS150 Sequence/Annotation Release
WB_DNA_textTH:320-a81110ggaacatggcgaaaataggatttaccagaaatttcgaaataactcaatttttctagtgatatttgtcaaaataaatggttttctagtttgtaaaataagtttttaactagattaagtagaatttgtcctgtaattattgcgaaataactatgtttcttgattttaggctctattttcaataattccggatttcctaatgtttttcttcgttttggaagtagtttttattaattaatatatttaaatttcagaaaatgtctcaatatgagcgattcgactcggtgctgctctccatggcccaacagctgagcggcggagtgcctgaaatgcttgatgtactatttgaatttctttcgaggtaagaaattttttcaaagtgcttaataaatacatgttttgtttcagaaagacggatttctacagtggcgctggtgtcgatcaagcccggacccttctcctcgaaaaattcgataaacacggtggaaaggctatgaaggaagctgaagaagccaagaaacggaaggaagagcaggagaggaagcttgctgaacgaagagctgcacaaaaagctaaggaagaggaagagttccgaaatgcgaaagtcgtggaagtcactgatgaggaagcggccgcgtttgaaaaggaacaggctaaaaattctgttgaaaatcttgaaaaattcgtcgataacgaaggagaaacatcgaaagacgctgaagtcgaagatgaggacagtaagctcatgaaaccaaatagtggaaatggtgcggatcttgccaaatatcaatggactcaaacactccaagaactcgaggtgaagattccaattgctgctggatttgctatcaaatctcgtgacgttgtcgtcaaaatagagaagacttcagtatctgtcggcctgaagaatcaagctccgattgtcgatggaaagttgcctcacgccattaaagtagaaaattgcaactgggtaatcgaaaacgggaaagcgattgtcctaactctcgagaagatcaatgatatggaatggtggaatcgattccttgattccgatcctccaatcaatactaaggaagtgaagccagagaactcgaaattgagcgacttggatgg