Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:320-c10   

Cenix:320-c10RNAiCenix:320-c10
PCR_productcenix:320-c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59A2.1a Source_evidenceePCR1350WS150 Sequence/Annotation Release
Overlaps_Gene F59A2.1 Source_evidenceePCR1350WS150 Sequence/Annotation Release
Chunk_score Abs_score1287
Max_abs_score1287F59A2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII34012103402868
Overlaps_transcript F59A2.1b.1 Source_evidenceePCR1350WS150 Sequence/Annotation Release
F59A2.1b.2 Source_evidenceePCR1350WS150 Sequence/Annotation Release
F59A2.1a Source_evidenceePCR1350WS150 Sequence/Annotation Release
F59A2.1b.3 Source_evidenceePCR1350WS150 Sequence/Annotation Release
WB_DNA_textTH:320-c101659ttttcgatacggaaattggcacagagcttatggacttgctcacgacgcatcacgattcgatatttgttgtcattgcttttcaggagctgaaataataaattatttttctcaaatttagcctctatgagtcaaaaatcagttgttttcttaatagttttcattaaaatttagtgaaaaaacatagaaaatacttgcaaaacagttgaaaagtgcgcaaaactagcacttttcttaactgtttcaactgaaataagttattttctacgttttatcactaaattttaatgaaaactatcaaaagaacatgccaagctggctcattttgatataaaatcctaaatctgaccttaatatctccgagtccacgttccttattctccttgagatccgaatagtacttataaagcttgcatctggcggagaacatgacctcctcgtcctcttcaccagttttcacctcaaccaaatccggaagaggaataactggcttaaactcgacttctggctcatactccccatctccatcctcattcgtctcatcaccatcgtgtgaagttgcagaagtcgtgttcaacgtggtgttcttgctcccgaaaatgcttgccttcttctgagcagcaagttcttcttgggccttcttgacatttgctgcgtcgaaaatggagccagatttggcagagttggctgaaagggcagcgaatgttgcacctccagacgtgaatccactaccgaacacggattttggcgtctcggactgtttattttcttcttgtttagctggtgcagtcgttgatggagtctgttgctttccgaatgagaaagttggctttgggaaggcactttcagaattcttggcgaacataaacgacggagtagtagttgaagaagctgtagattcagtcttggagagtccacctccgaacaatgaatttcctggagtcgtagaggttgccggagaagcagttgaagctgcaggattgttgaaattgaacgatggggtagttgcattgacagcggcagctggcttgttgaatgagaaagttggagtattagcagcacctccaccgaaaacgcttgttccctttggtgttccaccaccgaaaatgctactgctagtgcttggagatccgctgagtgatccaccgaactgagatgtttgagcaagaggttccttggctggagcagatgctccgaatccgaatgtcacttttggagttcctggggcaggctggaggatcgaaggtctgcaaatttaaatttttaattttaagataactcaaatagaatatttacttagagaatatatttttctctttgacagatccgtctttcgatgtcccacaacaggcacattcaatctcgtcagctttgcaagtaacatagcatccagggcattcccaagatcctggttttggcttgaactgatctccaaatccagtctcttccggtttgttgtttgatggaatcacaacttcttgcttgacttccttcttcacctcagccgccggcttgatttccttgtcgatggtctttccagcgttgctcgatgattttgcctcagcgacagccttctcgaacaaagtcttaaactctccagcgatatcgacgttagcgaaacgagcggaaagcttcacgtgagctggctgatcttcggaaaag