Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:320-d4   

Cenix:320-d4RNAiCenix:320-d4
PCR_productcenix:320-d4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC44F1.5 Source_evidenceePCR935WS150 Sequence/Annotation Release
Overlaps_Gene C44F1.5 Source_evidenceePCR935WS150 Sequence/Annotation Release
Chunk_score Abs_score851
Max_abs_score851C44F1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII37794333780632
Overlaps_transcriptC44F1.5 Source_evidenceePCR935WS150 Sequence/Annotation Release
WB_DNA_textTH:320-d41200tgtgtttttgctattgcccactcataaactttgaatttttcattcaaaaatttatcagagactcaccgtattcacaattccacacacaaaaaggatcacaataatcaaaataatactgactgcgtgtccagcagatgtacgagtgatgaattgggagaatgtctgtaaatagcttaaattttgaaccaaatatcagacaaaacccacgtgaaagtaatcaatgtatagcatgagaagaatgaagaacataacagtcaatgctccaacaatcagtgctaaacttgtgataagtcttggcatcacgagcatatgatatatcccatagaccactagaaagaatatggaaattgcaagagatggtatgaaccagtgatctgtttccttgtgatattcagcttcaagaccagggttccgaaatctttggcttaatgtggagatgatggttgaatgttcgaccttcttcttttgcatatcaaacttctcctgacttttctctccttttcgctttttattcgttcccatggttttgagagttggattcatggcgacaatgctttggagcactcggttgacggcttggggtactgtcaccaatgagaatctgaaattaaagtatttagattttgttctgttacatttcataccttttattaacagggaaaagttctggtgatggtaagtgtccataaagtttccatccaattggacatttttccagttcaaattctcccgttgaaccaaggaaacgacgagtttcatttgatacgtagacacctctgaaattttcaaaattataaaaaaaaacttcaaaaaatgcttgttaggatagtggaaaacctgatctacctagttataaagttttttttcaaaattttagtaaaactcacggttcagttgcattactttgcatgagcagagcattatcaaaaactgatccaataacatcataatgccattttgaaactccaacaactccagccgtaacaggaccactatcaattccaatacaaaccgatacatctgctccagttgcatctcggaatgaattgatcaatgtctccaattccatcgaaaatctgcataactttgtcgcatgctgagaatcgattccaggaattgaacaaactgcagttattccttcagacgccactcgagtacatccatttgatgctgcaagacgttcgattcggctatcaagct