Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:320-e12   

Cenix:320-e12RNAiCenix:320-e12
PCR_productcenix:320-e12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (5)
Overlaps_Gene K08E3.5 Source_evidenceePCR1232WS150 Sequence/Annotation Release
Chunk_score Abs_score1148
Max_abs_score1148K08E3.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1376403913765485
Overlaps_transcript (8)
WB_DNA_textTH:320-e121447ttgaaccgtcccaggtagtccttgaccttatcgaatgaagatccgagcttcaccagcggtgttgttgggaaggatctttgatgagacagcgtcaaggatccattgtcaatatcgtaaagatttgacattaaaagcagaagatcagaagtcttcttgactggcaagaaacgggaacgtggcacattgactccaacagctccagagaatgacttgatggctgcaccagcggcggtttcgagttgaataacatcaagcccacggtcgagatgcttcggattgacgataacctccatttcgagcttgttttccaccacaatttttctcatggcgtcaagcttggcccacaagttgttagtattgaaaattcggaatttgctaatcgacttgaactcgtccacataatccttcggcacctgagcaatttcaagaagcataagacgtccttcgtactgaatgagagttcctcccttcacgtcagcacgggtcttatcggtgacctccatcaagaactccggagcagtttgatcgggagatgggttcagcacaaaattgagaatagaaagatccacggtagctcccatattgtcaatgttggataggaaacagtattctttgccgtcggcgaggaacttgtccaggagtccagagttgtggaaggcctcgtagaagtttccgtgacctggtgggtaccagcattcgttgtcgtcggcttcgagtgatttgacgattggaagaagagtctcacggttgatacgtgggtattgagattgggagaaggtatgcacggagacctgaaagattgtgtatgaatttaaaatcgaaagtttccgaattcgtattattgtgatgtaagtcgaagatgccataatgcggatatttgaacaaacacctgaatccgaattagaatctcaccttaacgttggcatactttttgagcactttctgagtgtcctcgtttgtattgaacgagttcatgagcacgaggggaacgtcgaccccataggttttgtttaaagtctgtaaaatagagatttaacagaatttcctccgtttcaaggctcacctgaatttgttgcatggtcaagtcaaggaaggtcagatcgttacggacagaaattaccgactttggtcccttgcaccccattgatgtcccgagacctccgttgagcttcaccacgaccaacttgcgaagttgcgaagcgataagttccttgtcgacgacatgaccgagctgaataattgatgtttatttggaatgcttacatttaagtcaacttacacttttgtacggacggatggctccctctggaagaggctcaatcttggaccaatcgacggtgggcttggcacgaagaaagcgagcgaagagattgcggaagcccgatagctctgtcttgttgtgattcaacgtctcaggtttgcaggttgaaagcaggtgagccaactc