Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:321-e9   

Cenix:321-e9RNAiCenix:321-e9
PCR_productcenix:321-e9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY43F4B.6 Source_evidenceePCR1481WS150 Sequence/Annotation Release
Overlaps_Gene Y43F4B.6 Source_evidenceePCR1481WS150 Sequence/Annotation Release
Chunk_score Abs_score1421
Max_abs_score1421Y43F4B.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1330500713306591
Overlaps_transcriptY43F4B.6 Source_evidenceePCR1481WS150 Sequence/Annotation Release
WB_DNA_textTH:321-e91585tgcgtcttttcagactccctttgctgcatagcctctatgaatgctcgctgctcatccagtgccttttgcctgttctcgtccttcatcgcgatctgcttctccaagtcatccaactcggcttgcaactcgggaagtcgttcggtatcgtagattgtgtcatcttgtccaccaagtgccgtttcatcgttgtcatcgtcggcgagagtcgtcgattcttcggtatctccaaccacttgttgaatggatcgaaccacttcagctgcatcaagcatctcctcattcaggacggtgttacggacgtctgtgagcattgattggagtttagctttgtcttcttccaagcgagagttcttctgggtcagggcactctgtaaaattgacattgatattggtcagcattagaataaaaaagctttaaaacctaccattcgaatgatgcactcggattgcttcatagcacgctccttcaactgctcagtcttccgaacaacttcctccttgagagaaagaatctctgcagaattgttcgcatcgttgaagcggacttcagccggcgcgattccttgcttcaggtcagcattctctttctgaaggcgcttcagttgagcttgtaggatggcgatctcctcggctttcggatttttgttgactatcggcttgttcttgatctgcttggcacgatctgcatagcgaagcgtgttgagagtctcttgagagttggaatcagcgggagagatgcaggcaagaaagactgtgaacgaatttccaccgagagaatcttgaaggacgcgggtgatcacagagtttctgtatgggatgtgcttctgcttcgtggccaacgctgcgatgacttgggaaagaatcaaaagtccaccattgatgttgatgccttctttcatacgatttccttcggcttccgtcttcttcagcctctcggatccagccaaatcgaccaattggagcttcgcgctgaatgcgctatcacactctgcagtggcagttttctccacgaacactgtgaaaaccgcatgagacctgctggacatggcgttcatcgcagtttccgcctttgttcgatagtggcatccgactgccagctgcttgagcgctcccttcaaatcgataacaggaactgccgtcagattcacgacggtgcagttcttctcgtctccgtgcacattcagcttgactttgtccggacgaagaaggtcgtacacgttgtctccgtagacctcgaacatggaaacggtcaccgcaaacgattctggagcctcggtgttcatgattctttggaacaacgcactgacgagacgcggaataattccacgacgcatttcgtcggtgccaacgttgtcttcagtgcccatggtgtaggtctttccacttccagtttgtccataagccaacactgtcgcattgaaacccgcgaaaattcgatccaacaagggcagtgcagttgtctcgtagacgctctcctgatccgacgtgtcagcaaagaccgcatcgaaggtgaacgttgccgactcgtttatcactatctgaaaaacaaagattttaggatttttcggataaaacgcaggaaaaa