Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:322-d12   

Cenix:322-d12RNAiCenix:322-d12
PCR_productcenix:322-d12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K03H1.10 Source_evidenceePCR1024WS150 Sequence/Annotation Release
Chunk_score Abs_score899
Max_abs_score899K03H1.10
Specificity_index0.798
Rel_score1
Map_statusUnique_ePCRIII99230889924507
F40F12.7 Chunk_score Abs_score228
Specificity_index0.202
Rel_score0.254
Overlaps_transcript K03H1.10.1 Source_evidenceePCR1007WS150 Sequence/Annotation Release
K03H1.10.2 Source_evidenceePCR1024WS150 Sequence/Annotation Release
WB_DNA_textTH:322-d121420tctggacggcaacttcttttggattaagcatgcttgcactgcagcaagatcccgtgaagcagaagcttgttcagcaacaacttgttctcttactccatgcacacaaatgttcactacgtgacaaggtatgttttaaagcatattccggtttccgaaatcagctattccaggaaaataatgagtttgctgccaggaatcaaccacttcctcatactacctgtagattaccccattgcccaactatgaaggaagtattgattcacatgacaaactgcaatgttggtcgtttatgtcattgtaagtctattacgagctggaaagagtttcgaacattttcgcaagaacaagcgcctatttccaccaaaaatttcgcttcacactctagtcactgcttcagctactacctcacaaactaaaaaaacgttcagtcgctcattgtgcatcgtctcgtcaaataatagctcactggaaaaactgctcgagggaagattgtcctgtctgcacaccactcaaaagggcacgcgatgtcccgttaatattttcatgtaagttctatccatcctacttcagaacattttcgaataattgttaatttacagtgccccatctggccaatctgataggcaccaaaggaaattcttatggaagtgcagatggtgaagtagttcatcaaatcggggtgtcgacaatgtcagcgggacgtataacaaatggaaatatttcaaacttaccaccgccaaatgtgccggttcgtacaaaggaatggcatcgtcaagttacaaatgatctcaggaatcatattgtcggaaaattggtcaaagcgatatgcccggcaccagagatgatgaatgatattcggttaaaagatttgaatgcctatgccagaaaagtcgaaaaagaggtgtttgaaactgcaatagaccgaaaaaattactaccatttgttggctgagaaaatttacgagattcaaaaagagcttcaagagaaaaagaattcaagacttaatcaaggagctgcccaatctccgttggatgagtttgctcgaatgcgtattgatgaaggtggacatcagttaaggtagaaatgtaacatcaaaccatatataacatttttcatcacagaaccaaccaagaaactgagacaaataggcaaaatcaaagccaacaaccattaatggatatcaatgttcagttgaatgctgcaaagacagaggaagaactcgaattggtatttgccgaacttatgaagaatccacagttgttccatgcttgattctctgtgagttctgactccaactcttaacgcatcttacttctgctcagaaagtcttgatcaaaaactgatatcattccaatgcggatccagtgtttttgaaggttcctctaatagattattttcagatgcgggaaaatcaaagatg