Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:323-a8   

Cenix:323-a8RNAiCenix:323-a8
PCR_productcenix:323-a8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY41C4A.11 Source_evidenceePCR765WS150 Sequence/Annotation Release
Overlaps_Gene Y41C4A.11 Source_evidenceePCR765WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681Y41C4A.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1172167611723347
Overlaps_transcriptY41C4A.11 Source_evidenceePCR765WS150 Sequence/Annotation Release
WB_DNA_textTH:323-a81672aagccatggattttgactgctttgcacactggaaatgttcaaatctggaattatgacactaaaacgttggtcaaggctatggaggtgagttaaaacgattctgatttttcagtaaaggagggggtgtactctagctctacttacataggggtgcttatctcagcggagagaaaatttttcagaaaaatatctactagcaagttatagaaaattttaatttcccacattttccaaattgatcacttttctatttcaactctccagccccgataaactggtttttactaattttttgaaacttttgtattttttggttcttttttttcggtcgttttttatggaatttatgatcgacttcggaatgcccaatttttcctgacttttgacttttttgacttttttttggatttttcggaatatctgggtatttctcttttccctcccccagccccgcctaagcctaagactaagcctatacgtaagcctaaacctaagcctaagcctaagcctgagcctaagcctaagcataaccataacccgaagcataagcctaagcctaagcctaggcataagcctaatcctacccgaagcgtaagcctaagtctaagcctacgcctcagcctaagcctaaactagaacattcacattacatttgccaagtttttcaccgtttcaaaattcataaattatatttccaggtctccgaaaaatccacgcgtgccgccaaattcatccatcgtaaaaactggatcgccaccgcttccgatgatcagcaaatccggatcttcgacgctgaaacgttcagcctaatcaacgagttcacagctcactctgactttattcgctccctaaccgtgcacccgacacttccctacctcatatcggcttccgacgatcgtaagatccgagtttgggattgggaaaacgagtggagaatggagcaggaattccaggagcatgctcattatatcatgcaaattgccgtgaaccctgaagacccggagatgtttgtcagtggatcgttggataaaactttgaaagtctggaagctcggtgagcaagagtcgatttgcactctggagggtcatgagaagggggtgaattgtgtggagtttctgaccggtgggagaattgtttcgggctccgatgattgctcaatttgtgtttgggatattcaggtgagcgggaatttgaagttttataaacatggtgcatcgagcggaaacaccacgcttaactttaggagctcgtatatcgctggtattttattctatcaaaatgttgctaattgacaaaatattctttgtttgtttctctataattttgtaattgacaactatttgataaagtccaaaccaaccaagataaaagtggtcaaagtttaaaaaaagacatggtgcatcggaacatttttcagacccaaaaatgcattgaaactctaaaaaatgctcacaaaaacaacgttacctttgtcaccccattcaagacatggattatctccggagccgaggattctactgtaaaaatttggaattcgcagactttctcgtgggtttctttagctcaacttcaataaaataaattcaaaacctaaaacttcagattggaaaaggagttgaattttgagaagggaagagcttggtgtgtggctgctggaaaatccgatgcaatt