Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:326-b11   

Cenix:326-b11RNAiCenix:326-b11
PCR_productcenix:326-b11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST24C4.7 Source_evidenceePCR814WS150 Sequence/Annotation Release
Overlaps_Gene T24C4.7 Source_evidenceePCR814WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII893191894386
Overlaps_transcriptT24C4.7 Source_evidenceePCR814WS150 Sequence/Annotation Release
WB_DNA_textTH:326-b111196ctttttgcttcgccaaagacgaaatatgaaagatcagaaaatgttcggttttttatgatttttttgttgagaaatctgaatttttaatttacaaaatgttccgttcttcgaaatataaattttcgaattacttacaaagacttttcttccaggttcaaaactagtgttcaatcgattctcaacaccttcctcttcatttctcaattctgaatgataagaaatatacttgtcgtgaatgatttcttgattatctccattatgatataaattaggagcttttctattgaacattcgttcgaatggcgtctccattcgatcaggaatcggtttctgattatattccattacgagaaattgcaattgttctacccatcggtttcgtgttccaagctcattttgagctagttccagaacccatcgttctagacaattatacggaagcggttcattccaaacttctcgaatttccacagcatacacactttccaatgattttattgtatcccggatgtatgtcggcgagaatgatgttgaaaatccctccggaacaccgtattcattaaaaatcgagttcaaaattcgtccgatcgctgttcttgtgcactcgaaaagtggtttcgcccacaaaaatcgtgttttcagacaagtgacgatgagaatgttgtcgtatattttgtttccataaattgaagttggcatctcatgaacatcgatttgaacatattgcattggatgattagcccaacatgctggtttaatggggaacactatatccattggtctagcattatctgcattgctattctgagattctgtgtcaggagcatgaccgatgtgatagagctgcatgaacgtatgtacttcaccgctggaggattcgacacggtatgagatgactgaggggcacgctgatccttctttcaacattctttcacgtgggagtcggtgtctggaagaagagacattataggtggagtaccgaaatagttttagtttgaaactggctcgaaagttgtctgaaattccgttttgggcctataactagaacaagaactaaaaaattcgttactcatttaaaggtggagtaccgaaatctgagactgcttttttagagccaaaatggtccaaaattatcaaatttcgcaatgagacgctctgaaaatgttttttttaagttacggccgcttaaagttttg