Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:326-c8   

Cenix:326-c8RNAiCenix:326-c8
PCR_productcenix:326-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34C12.3 Source_evidenceePCR509WS150 Sequence/Annotation Release
Overlaps_Gene C34C12.3 Source_evidenceePCR509WS150 Sequence/Annotation Release
Chunk_score Abs_score404
Max_abs_score404C34C12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII34639803466175
Overlaps_transcriptC34C12.3 Source_evidenceePCR509WS150 Sequence/Annotation Release
WB_DNA_textTH:326-c82196atcgtgacgtgacccattttttctcattacaggcggcacagttcccaacacaaaatacgtattcatgggagattatgtggatcgaggacattacagtctggaaactgttacactgcttttttgtcttcttctcaagtattttttgattctttttcctaccaaaatttctgtaaaaaactccaaaatttgcagatatccgaatcaaatcacactgctccgcggaaatcatgaatctcgtcgaatttccaatgtttatggattctacgatgaatgtcagaataaatatggacacggaaatgtgcacaaatggttctgtaaagtaaggaagcgatggaaattgaatggaaattggaaattcgtcgtgcagaaaaagcgataaaaatcgttaaaaattcaacgttttggcgaaattatacgcgaaaattcatgaaaaaatgatttttgtgcgattttctgataattttaaaaatttaactgaaaaattggctgaaaaattcaaaattcgtttcaaaatggctccaaaagtaaagctaaaaataagtcgaatttttataaaattaaaaatttcatataaactttccggaaaattgtttttctgtaattttcttttttaaaaaacttcaaaaaaacatgaaatccatcaaaattagtttttgtgcaatttttggactcaaaaatgctcgatttttttctggtttttttaaagaaaaccttcaatctgcagaatggaaaatttccaaaaaatattattaaaaatgctccgtgagctcccaaagttcttctcgaaaatcgcttcaaattatttttttaaacgagaggtgattttgtagaataaaaatgacgaaaataactttttactgtcaatttttgcggaaaaaatccgagtttttacgggataattggctcttaaagtgctcaagcactagattacgtgtcgaaaaatacaatttttagccgataattgtatcgaaaaggtattttttcaccattttcatcaaattttcagtttaaaaaactaaaaattaattttttttcaggtattcgacgttcttccaattggagctttaattgatgaatcagtactgtgtgtacatggaggactttcacctgatattcgaacaattgatagtcttatgttacttgatagagctcaagaagttcctaataaggttggaaattttaatttatcgtgaaaaattaatcgaaaaataaataatttaccggaattaatcgaaaactaaatgtttttatttggaaaacattgaaaatttagagataaaaaatataaatttattcaaaagtttcatttttcttggaagaaaatccgaaaattgagaaaaaatatacgagaaactataaatttatcaaaaatatgcagattaaaatgagaaaatcgagaattcgggaatttttggagaattttactctaaaatacgaaaaaaaaaattgtttttttaatacgaaagtcttgttttaaaaaattgaataaaaaaccgagaaaatttgaaaaaccgaaattatcaaataatgattttgatgagaaaaatcttaaaatatattcaaaaagatgaacaatttcgattttgaaaaatccaaaaaaagattattaaaattctttggattttctcataaaaaattaaaaaattaacttttcgattgcaaaaaaaattttttttttccgaaaaatgaaaaattctcgtttttttttcttcaaaaaattgcgaaaaaaatacgaaaaattagaaaatttactcaaaatatatgaaaatgactggaaattttcaaaaattatttttttttactaaaaaaaaatggagaaactcaaattttcaattaaataaattatttccaaatttgcagggtcctctatgtgacataatgtggtcggatccggatgatgacgtcgaagattgggtgattagtcaaagaggagctggatttgtaagaaaactgactgatctgccgaatttgggcaaaaaaaacaaaaaaatttggattttttctttttccaactgaaacttgatagttttttttgttttttggtccgaaaaaacctttattttttttgccaaaaatacgacagccctgtcaattttggaatttccactttaaaattaattttttttgcaggtgttcggagcaaaagtgacagaagaattcctaatgaataatgatctttcactactttgccggtcc