Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:326-h7   

Cenix:326-h7RNAiCenix:326-h7
PCR_productcenix:326-h7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C56G7.1 Source_evidenceePCR556WS150 Sequence/Annotation Release
Chunk_score Abs_score493
Max_abs_score493C56G7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII33926533394362
Overlaps_transcript C56G7.1.2 Source_evidenceePCR549WS150 Sequence/Annotation Release
C56G7.1.1 Source_evidenceePCR556WS150 Sequence/Annotation Release
WB_DNA_textTH:326-h71710ttttgtgtgagtttgcgagccagtttaagcctcatccttgtccttggttccgtgtttgagcatacgagtgaactccacgtagtcgaattgtccgccctgagaaaaaaaaaattgaaaattggcttatttttcaggaaaaaataaatattttagggttttaggatttaaaaaaaactattttgcattggaaaatttggtaaaaatatgtgttttttttatagaaaattgtgtcgatttacgcagatcgtgtactccccgtggagaagtttgcacttttttctgttgaaaaaacaagtaatttcaacatcgatttttttccttcaaaatctacaataaaaagcgaaaattatcgcaattttttgcaaaataaagaagcaaaaacttcttcactaggagtacacgaccggcgtaaatcgacaccaaattttccggctgataaatcgaaaatctctgaattttccacgattttaagaggtccaaaatcaagcttttcgagccagaaactcctgtttcccttctttttttcgttccgaagttacagcgattataccttaatcggagcatctctaaagagctcatcaacctgttcctcggaatatctctcgcccatcgtggtgagcaactcgcgaagatgctcctcattgagttttcccgaattatcctcatcgaagcattggaacgcattccgtatgacttcctccggatccgttccagtcaatttttcaccgaaaagtgtcaggaacattgtgaaattgatcggctgtgctccgggagcctcgttaatcatcgaatcgatgaattgttcggtgacttcttttccaagggaagcgaacatatccttcagatcctcttgatcgatgaatccatcgcggttttggtcgatcatgttgaatgcctcctgaaattgaatttattttaattgttctttaaaaattccgctgaaaccaatggatttttcgtctttttaaatttttattttttcgaaaaaaaaaacgaaaaatgaggctgtcacctactttgaactcttgaatttgagcctgatcgaacatggcgaacacattggaagtggctctttgtggccgttgacggcggtttacggttttgcgggaggccatggcttactgcaaaaatttgaaaatttgcgatttttgaggaaaaaataaggtctcgacacgacaaatttatgttaaatactaaaaggtgagcgcctttaaagagtactgtagttttactaattggattttttttctcgaaaaatcaatgaaaattcgggaatacagtactttgaatttaatgaaaatttgtcgtgtcgagacctttttttgatgcaaaaaacgtctagactcctcgaggaaaagaggaaaaaagtttccgttgtttttttgtgagaatttcaatttttggccgaaattttgataatttttgcaaactaatattgtttttagcattgaaatcgctaatttatcgtttattagcagtatttttgaaacgaaaattgatattctctcaaaaaacgatgaaatatgaagatggtagaaaccaaaaaaatgtgaaaaaaaactgaaaagatgcggggcgtggaaaatattatttgataacgaaaaagcggtgagtcaccgccgcaaaaaatgttttgtttcagtttttttgtttcctattacgattggaagcgaggttttcgaaggaaatattgattctcagcgtttgtcg