Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:329-b4   

Cenix:329-b4RNAiCenix:329-b4
PCR_productcenix:329-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST19C3.2 Source_evidenceePCR649WS150 Sequence/Annotation Release
Overlaps_Gene T19C3.2 Source_evidenceePCR649WS150 Sequence/Annotation Release
Chunk_score Abs_score482
Max_abs_score482T19C3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII614653616715
Overlaps_transcriptT19C3.2 Source_evidenceePCR649WS150 Sequence/Annotation Release
WB_DNA_textTH:329-b42063tctcgatagaccccgaacacgttgtgtgcctcatttcagaaaaccttagtcttaaaacaattcccagaacctagaattctgaaaaaacgaccaggaaacagctaaaaacatggaatgaatgaaatgggaggaaagacgaagaagggcgccaccaaaatgggcggagcctaaaaaggggctcctgaaaagatgaagagagagagagagaaaagatacgaagggaaatgagcgggaaaaatggacacaaaaatacggaaacaattgggttgaaggagaagaaggacaggggaaaaggggtatttggaaaaaattgacctgaaaattgaggttagaggcgtctcggctttacggtaggctttacggtacaagtctgaaaaaaagaagattccaaatggcaatccttgaaactgaacattgaatgtaggcaagtaggcatggcaggcaaaccatgcttgcctcatgtcgaccccctacgcgcctatctaacccctcctgccgccttttctttcaaaattttagattcagcgcaccgtccatctatgttatccaaaaaattcaactcactccattctcctcccaacataaaaaatgctcatttgttcgaccaaattgtgcttccctcctctgaaagaaacatgaagaccaccataaaatgtcggggaccactgccataaaaaacgtattaattgccttccagacattcaattattaagcccagttctaaagatcagagcacaaacttcggagcttcgaagccccaaaaaaatataaataaataatttatttcacaatttgtcaatatatgtgtgtgtgtgtcaaaagttttaagtttccaaataaatgaataaataattcaaaagtcgtgagttttattttcctgacaggtacggcttcagctcacactcgaaggtttgtggatttggtgtgtatgggtgacagcagcagcggcacaccgatccagatgggctgaaaacgtggatttttttggaaactgttgatttttgaaaaaaatagtggctgttaacccaaaacagttagtggtaaaaaagttgttaactataaaaattctgcgaaaaaattgcagtatttttcaattgcaaactttttgataaatctcttcttacaaagtcacaagaatccaaacactcaccgatgctctggaacacactgtaaatagtccaaattatcaataatctgttgcatagattcagtaacatttgggagtttgatttctggatttggccataatttgcagtcctgtttgaatgttgacacacatgctttgctctgatcaactcccatacattttctctcagcgacgaataatggattgatgattccgatgtcgcctctgaaatttcgtcatttttggaaaaagctgagtatgtatgatgcattaaattagtgaaccgcaatgtgtcatatcaattagacacgcgtggtgtcagagtgtcttattttggtttgatctacgtagatcaacaaaaaatgcgggagttgagacgcgaagttttcaactaatttcgcctggttaaaaacgtgctgacgtcacattttttgggcaaaaattcccgcatttttttgagatcaaaccgtaatgggacagcctgacgcttatttgacttcatgcgatctacagtaactgaatgcatttttcgcgtaagctatagtgcaattgacgcaatttttcccagttctccccaccttctatgacattttctaccacaactctgttgataagagcactctccacactgctcttcactagttgtagtatctctcagataagtgtagaaattgttgaaagcctgaaaaaaaagattttatccgcacttgttttatctgtttttgatctttacaaatccgtgtctttactgaaagatatcgatctttttcgcaagttttttcgagaaacggtttgcgtgttccactttttatggcgtctcaaatcggcacaaaaaatcttaccactccccaacgatccttgagtagacggaaaaagacgtggttgcggcatccttttcggccagggagcaactgttcaaagtaggtgcgttgccatc