Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:329-f9   

Cenix:329-f9RNAiCenix:329-f9
PCR_productcenix:329-f9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T07C4.1 Source_evidenceePCR78WS150 Sequence/Annotation Release
Chunk_score Abs_score78
Specificity_index0.117
Rel_score0.171
T07C4.3 Source_evidenceePCR153WS150 Sequence/Annotation Release
Chunk_score Abs_score132
Specificity_index0.198
Rel_score0.289
Map_statusBottom50_percentile_ePCRIII1035482710355762
T07C4.4 Source_evidenceePCR498WS150 Sequence/Annotation Release
Chunk_score Abs_score456
Max_abs_score456T07C4.4
Specificity_index0.685
Rel_score1
Map_statusBest_ePCRIII1035482710355762
Overlaps_transcript T07C4.1.1 Source_evidenceePCR78WS150 Sequence/Annotation Release
T07C4.3b Source_evidenceePCR153WS150 Sequence/Annotation Release
T07C4.4.2 Source_evidenceePCR351WS150 Sequence/Annotation Release
T07C4.4.1 Source_evidenceePCR498WS150 Sequence/Annotation Release
WB_DNA_textTH:329-f9936cccttctaccgtgtgtggttttctagtttacgtgttctcagggtagctgagaacttttcccccattcaacaactagaaccaacacgagttctaattttaataactctaaaattccacgcgcacaaaccaatttcgccgttgtttctgtttttgttaaatgaaagaatattttgatgattttgaaggaaacatttattattcttagcacaaatcaacatccttgcacgccttgtctggagaatccttgttctcaatatcctttttcagctccttcttgaccttcttcagctcttcctcacactcgtgatgcaacggcaacagcatagtccagcaaagagttccgatgttcacatcaagccatgcatcgagatcatcatctccaaccttctctccaccctgaaatatgtgaataacgaggaaaattggagatatttggagcacaaacctcgacgagagccttgcagacatcacagaaaacaccgtgatgcttcttgagattgagtgggttagctggattggctagaagtggagcagcggcgagcaagacaaggaaaagacacggaagaatgcgagtcattctgtagattttaagatgaaaaactggagaaatgaagcgaaaatgcacccggagcagtgatgctcgtgtcttttatcaacttcgcggcggcactgataaggaatcgaatcgtttctgatgttttcagcatggaggaaaagatcaaaggacattatagaatacacaccgggtcgttcacacatcagatgccgatttttcgaactgataagatcgcttagaggagtagcttttcgccttgacggagaaaatattgattaatcaggttagcagtaaagtaaatggtgtgggcatgtgatttcttgataatttgaggaagatggaggcaatcaatttacttatttcaacaattctggggaagc