Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:33-b6   

Cenix:33-b6RNAiCenix:33-b6
PCR_productcenix:33-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14B4.2 Source_evidenceePCR911WS150 Sequence/Annotation Release
Overlaps_Gene C14B4.2 Source_evidenceePCR911WS150 Sequence/Annotation Release
Chunk_score Abs_score869
Max_abs_score869C14B4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1934619919347823
Overlaps_transcriptC14B4.2 Source_evidenceePCR911WS150 Sequence/Annotation Release
WB_DNA_textTH:33-b61625acctacctacgcctctcggtatttttgtctgcatctctgtttgtctttccatctggctacctacctacctaacttcctacctacctacctacctgcctacctctacctacctgcctgcctacccacctacctacccacctacctatctaccaattttaaaactcaccgaatcagagccgtttccatcacatgaaccgacgaaaatggtgcaataaccgcagcggccgtcaatttacaggctatcaccaaacccggtgcaactggctgcttctcatcacccgaatcaatcgataaattcccatcgaccgtcaggctcccggcaacaatatccacctgtccctttaaagttgccaccgagacgcccacatacggcagcgaaatctgcatttcgttacaccgaatcagaccgtcaaatgtgcaggatttcagagttttgagcaaaatttcactggaaaccaggcggcctccgaagttctccgagcagtcttcatggagcacaatgttcatagagtatttcacaaaaattgtcccatcctcggattgttcgatggatcctgaaattggagagttttaagtgtgatttttggttttctgagctcaagagctttcatttaagccccatattgccttggtttcatgcaatttgaaattttggccgcgttgcggtcgcgtcgcggtcgcaacacagttttgcacttgtggctccaattggaacttagtgatgcctttgaaatgaggaaattatgattactgaaagtaagagctttcatttaaaccccatattgccttggtttcatgcaatttgaaagtttggccgcgttgcggtcgcgtcgcggtcgcaacacagttttgcacttgtggcttcaattggaacttagtggtgcttttaaagtgaggaaattatgattactgaaagtaagagctttcatttaagccccatattgccttggtttcatgcaatttgaaattttggccgcgtcgcggtcgcgtcgcggtcaccctcaaaatttcaaagttatccaaacctagtcgatatgggtgccaaaattttcctctcaaactcaggattccaattttccaactcaccagtcaccattttcaaatttttctccacctgccacagagcatcatttctaaagcatccggtgatgacgtcactgtccccgatcaccaagactttgccagtacacgtcgtgataagctcatttctcacataaatcgataaatcggtaaccgtcattgatcctccgacggtacagtaccccttacacgtgagacggagcacatgagcctcggttctcgagttgccgaaaaagtgggcggagtcttggagtaccaggtcaaattgctcggtgacatggcaaaatccgctgaataacagtgacagtgcagaaatgctcattgactcttctatgaaaatctttgcattttgaagaattgtgaggctccccgccacatggcaccaggcggaggtcaactgccacgtggcactcgtctcacaagctcctttgacttcaagctcgagtttttcagactcaatataagatccttccttgaaaattgcatttccaagagtttcaatgacaaggctctcaccggcgcaccacattccttcgcagtcgaat