Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:33-e4   

Cenix:33-e4RNAiCenix:33-e4
PCR_productcenix:33-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene (6)
Overlaps_pseudogene F40D4.4 Source_evidenceePCR1202WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV1718664017188177
WB_DNA_textTH:33-e41538acacctacaaaaggcatccgactgggatcttctacctgtcgatttaccgtgtcctttacgtttttctcgtgtttttctaattgggttattcaagtaatgtagcgaaatgtatttaaatacatttgtgacgtcacaaatgtattaaaatacatgttttcatgtatttgagtacagtaatttttctacgatttttctacattttttaattttccgacactacttgattaaccccataagttatattattctcagtgatttcgctaggcaaaatgcacctgctgttaaatattttcaattaccaagagcttccagatttatcacaggtctctgccactcatgtgctccacagctctcagcttttttgcttctggccaaaactatgcaaaagttctacacgctcttaccatacttgaactttccactcacacttttggagcatacatcatcattgcaaaaacgccgaaaaggctggaatccgtgaaggccagcatgctatatcttcactttgtcggagcatttgtagatgttggtttcagtgttttcactatgccagtcctacatttgcctgtttgtggaggccatccgctcgggttactttcatttctcggcgttccagtctcattgcaaacttatttcggactttctttacctacatgttagtttttcttcaaggtaccgtatttcctctattagtatcgcatgcaagactaattttcaattgacccgtaggggtgcaagactaatagaggctgcaagattaattttcgaatgcccaagaactttggaaagttacttattttttgtagaaaactgaactgaactgactgaatgtataaactgaaaaaactgaactgaatgtatggtatgaacaagaataaatataaacttctccagtatttcatcaattatttacgcgattttaagttcaatttatccaaaaaatgacaaatttgctgccgttcccgaaagtattgctggtcagacaaaaaaggggtgcaagactaatagaggaaatatggtaattgacataccattctgtaaataatttatcattctaacaacgtaaataacaacgaaaaaaggaggggtatctgtgatagtttatctgaattgagagacaccacttttgcagtaatggtcgcgaccattgtggtatttctggaagatcgtcgatatcggttggttaacggtcaaaagtcgagcaaaatccgaaaatggtatcggttattatttgatgcttttcattatgtttatgccacaacataccatgcgccggtattttttcccttcccgatcaaaaagatggaagatttgtattgaaaagtgtaagttttttaaagaagtgaattacgtataaaatatctcaattaagagacgtctctctttcagaaaattcagtgtattccaacagaagtttacgatcatccgcacttctttttgcgctagcacaatgggactcgcattgtcacttgtatattattcttgatgagtattgttttttctcaaatgtttttgcaagtcgggcttatttttcgtca