Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:332-a11   

Cenix:332-a11RNAiCenix:332-a11
PCR_productcenix:332-a11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.17a Source_evidenceePCR221WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3A.17 Source_evidenceePCR221WS150 Sequence/Annotation Release
Chunk_score Abs_score126
Max_abs_score126Y47D3A.17
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1126468211266102
Overlaps_transcript Y47D3A.17b.2 Source_evidenceePCR221WS150 Sequence/Annotation Release
Y47D3A.17a Source_evidenceePCR221WS150 Sequence/Annotation Release
Y47D3A.17b.1 Source_evidenceePCR221WS150 Sequence/Annotation Release
WB_DNA_textTH:332-a111421gtcactcctgcagcaacaaaaaaaccccggaaattttggatttcggcggttctttatttgatgttcgatagaataattttttactctcgagaaatgcactgaaacacgtggtgccaggctgttacgggttgatctacaaaaaatgcgggaatttgttgtccaacatttgtgacgtcagcactctcttaaccatgcgaaagcagttgagaactctgcgtatcttctcccgcattttttgtagatcaacataaatcaagccgacatgggacacactgacaccatgcttaaagtgacgtcatgacaccatgcttaaagtgacgtcatgcaagactaatggaggaactacggtaaatggatttgtatctagtctgaactacagtaaccaaggggatccgtttttagagaaaaaatattcggttttttctcgtcaaaccaacatattctagataaatctataattttcacgtcattttccgtatctctaacctttaacaaatcagctctctcggccaacgaattcttatccgtctcaactgtcccattcaatgctcgcattagctcgtcaccttgcttatcttcaaaaaaatcgatttttttttctcaaaaaaaaaacatttgaaaaaccctactcatcatattggcggctgtacgcaaatcacatagttttccagacatttgacgattcgccagaattagggcatccgatcgattcgagtcggttttcgccatttgagcatcctcatcctcttctggagccgcaaaaaatcgggtatttattgggatttttattcaaaatttgtgataataatatcaattgtttctattttttaatgagacacgttataatgtttagcaaaaaaagttttgctcgaatcgttttttcaaacaaattcaaaattctaatgttttagaaattttcagatttataagagcatttattaaaaataaaattatatactttttaaatttttaaaaagtccccatttttcacttttttccatgaaatgtaaatttcgttcacttcctttttttcaaaattttccctttttcagaaaatttcaaatttcaaactttttaggcatattcagtcaaaagtagctatgtttcaattctaaaaaaaaaactgaagactctgaaaaattccgattcatcggggtttcaaggcgtttaaaagttactatcacatttctaaaaaaattttcattcaaatttttcagatgctgttacgcttttgtgaataattcaaattctaacaaacgaaaaaattccgaatttcgaaattttaactatttttaagttattttttaaaattacttttactattaaaaataactatttttttttaagttttctgtcaaatttccacaaatatttcgaatttcaaattttttttttcttcaaatccctaccactttcagccc