Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:333-a4   

Cenix:333-a4RNAiCenix:333-a4
PCR_productcenix:333-a4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T28D6.5a Source_evidenceePCR357WS150 Sequence/Annotation Release
T28D6.5b Source_evidenceePCR357WS150 Sequence/Annotation Release
Overlaps_Gene T28D6.5 Source_evidenceePCR384WS150 Sequence/Annotation Release
Chunk_score Abs_score321
Max_abs_score321T28D6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1133467611335663
Overlaps_transcript T28D6.5b Source_evidenceePCR357WS150 Sequence/Annotation Release
T28D6.5a Source_evidenceePCR384WS150 Sequence/Annotation Release
WB_DNA_textTH:333-a4988atttttgggccaatttttcctcataaaatgtcatccaacaggaaaaaagggaatggaggtactcggagcagcagccacaacaacagtagaagcatgatgctctccttgtttatgcttctcgcacatctggatccagcaatcgctggctccgacaggtaggcttttttttggctcaaaatgtgctgaattttcaagaatttcggctcaaaaaatctcgaatactctagaatttcggaatttttcggcgataattcaagtttcagtcaacttttttttccagcagaaatcgaaatcccggtgttttcgtcagtttttcggggaaaaaaaacagtcgcccagctcgagctttctgtcactttctttctgtcacgtggtgtcaaaatgtcccatttcgttgtgatctacaaaaaatgtgggaatttagatgcagacttctcaactgatttcgcatggttaagaacgtgctgacgtcaattttttttgggaaaaaattcccgcattttttgaagatcaaaccgcgatgggacagcctgacaacacgtggtccgtctgaatttctgaaatgagaaaaattgaaaattcgaagactttcaatagaaatacaaccatttctatttgaaccttccaaattcttccaggagatcgtaccacccaaacccggacgccgaaccatacggaatcgttcaaccagcctatccatacgatccacatccgctttccgtccccgaatcgctggtccaatcgcctcgcgcgatcctatgcaacaatcagaccgagtacgagtgcgtctgcatgcggccctactcgtcaccgcattcgcccgttcggccgacacctgccgctccggattgcagtgtgttcatcaaggtataaactctttttagttgagcaaaaaacaacaaccgcggggccaccgaaaacacaattgttcttgtctgatggaagagagagagttttcctagtttcccccaagggagccaagttatca