Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:333-f1   

Cenix:333-f1RNAiCenix:333-f1
PCR_productcenix:333-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y111B2A.21 Source_evidenceePCR187WS150 Sequence/Annotation Release
ZC482.2 Source_evidenceePCR98WS150 Sequence/Annotation Release
Overlaps_Gene Y111B2A.21 Source_evidenceePCR187WS150 Sequence/Annotation Release
Chunk_score Abs_score124
Max_abs_score124Y111B2A.21
Specificity_index1
Rel_score1
Map_statusBest_ePCRIII1274699012748063
ZC482.2 Source_evidenceePCR98WS150 Sequence/Annotation Release
Map_statusTop50_percentile_ePCRIII1274699012748063
Overlaps_transcript Y111B2A.21 Source_evidenceePCR187WS150 Sequence/Annotation Release
ZC482.2 Source_evidenceePCR98WS150 Sequence/Annotation Release
WB_DNA_textTH:333-f11074cgtcaaggcacacataatggccagcaggtaagctttcgaacatacttaattttttaaaaactaaaattcagcgcaaccgatgacgtgccatatgaggcagccatggcggatcgagaatcgctcaaacaagctgtaaatgatgccagctctctgaaaggcttgaaggaggtaataatttagaaatgacagaaaatgaaccgtgatgacgaaatacatctgtaaaaaaattataaaaaattctaagctccgtttttaattttttttttcagttatattctgtcatagcggcctatttctctggaaaaaaaaatccaaaatagcctcaaattcggaattatgcttcgattttttttctgcggtagtcctgaatttaagacgattttgaatttttgtagctgcctttcgccacaattacgttaaacatttcagagcatgtcgaaagctggatggaggatcgtgagtaagatgcggaaagatctcaatggagcctgatgatccccttcccagcacacaagacagttttaattttgtgtctgtatagttttatattaagttttgatgataatgaatttttttacggttttatccatcacttggctcgattgaagctcctattgtgcagcacacacggcgtgtaaattagtgcatctaacctaggaaatgcgatttctaggccatggccgaggatccgactagatcttttttgatggtgtttgtacagagttaaatttcattttggagggaaattgaaggaaattgaaagagaaattaatttaataatattaatttgatttaaatgaccagaacaaaacaaataaactgaatgacaagccaatcgatattcgtccagactgggatgatgttatatgaactctttcacctgaaacatttaagtttttttaataaaagagcaagcgcgctcaaacgcgaaaacgctcgatccacttaatctggattttgtgccgattcatttatttcaagctatgctcgtttttttctgttatgtttcattaaaaagaccgaaaacataacaaaaagtgcctgaaaacgaaaaaaaaccggcgacattaattg