Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:333-f10   

Cenix:333-f10RNAiCenix:333-f10
PCR_productcenix:333-f10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC482.2 Source_evidenceePCR125WS150 Sequence/Annotation Release
Overlaps_Gene ZC482.2 Source_evidenceePCR125WS150 Sequence/Annotation Release
Chunk_score Abs_score62
Max_abs_score62ZC482.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1275002512750445
Overlaps_transcriptZC482.2 Source_evidenceePCR125WS150 Sequence/Annotation Release
WB_DNA_textTH:333-f10421atttcgcatggttaagagcgttctgacgtcacaatttttctgaaaaaatattcccgcattttttgtagatcaaattaaaatgagacagcctgacaccacgtggagttccttatatacaaaaaagttgatttttcgctcgtgatttttcgttgtaacatcatgaaaaatccagtgttctctgcaaaccactaaaatccacttttttgtttcagccgctccgcaagcagcttcgtcgaggtcatggcagcggccgagtttcccactccgctgaaactcggcacttaatatatgaacgactaagctagcagggccgccattctaccttaccagcaaaaatgaattcgttcacttacacacatcacacaccacattaaagtttcctttttctttgtcagctgtaaaaaccgaaaggcttgtcaga