Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:335-f3   

Cenix:335-f3RNAiCenix:335-f3
PCR_productcenix:335-f3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F58A4.3 Source_evidenceePCR867WS150 Sequence/Annotation Release
F58A4.6 Source_evidenceePCR92WS150 Sequence/Annotation Release
Overlaps_Gene F58A4.3 Source_evidenceePCR1010WS150 Sequence/Annotation Release
Chunk_score Abs_score947
Max_abs_score947F58A4.3
Specificity_index1
Rel_score1
Map_statusBest_ePCRIII96149339616513
F58A4.6 Source_evidenceePCR92WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRIII96149339616513
Overlaps_transcript F58A4.3 Source_evidenceePCR1010WS150 Sequence/Annotation Release
F58A4.6 Source_evidenceePCR92WS150 Sequence/Annotation Release
WB_DNA_textTH:335-f31581ttcttgcacgatgctacctgtataccgccctcgcagaagcacaactcggaaatctctcgcatgctgttaatattgttaggttggattcttgaaagtagaaaaggcttatttacgtggtcaatttcagagcaatttatcactgggccaaacagaatccgaacacggatattgtacaaagatgctgcgaaggagtctatcagaagcttcgagctattcatattttcggaaaagctagttcgaacaagtgattaaataaaatgttctcatttacaagtaatgaatctttattatttgacaaatagtaaacgtgttcacggtacacaaaagatcaaacagcgctaaaattgatgagataaatatggcttgaagatcgaaaaatgagtattgcaaatattgttatcagagatgtcgaaggcagagacgtctgtataactgaatatccgttgtcatgagtgtgacacgtttcgcatgggtggatataagagacgatccttcgaacatttcgaccaaaaatgcttccgccgcttcttgaagagcactgatggcgtcagaacgaatacggcagtcggcgccaaatggagtggaagtctgcataatttcgcggacgaggcgtgcgaacggagcctgaaatttggaattgttttaatatagtttaaataaagtaaaaattgtataccttttgaatcagaaggtcttcagttttttggtacttgcggatctcttccaatgccttctggcccggtctataacgtctcgttttggtgactctgttccttccggctctcatccgcacgcgatcggagctcgatgggccagttctattaccacgatcggggttcgatgggccagctctatttccatcgccatttgttccatccatagaatagttttcttcgtcggagctatcgtgtcgacggtatgagggcatatgatgacggccgtgggagtaatcgacaagattcgtggaatttctgccgacctgaaataaattttatgttgtttgaaatcatacaaaattgaaactaaccgtgaaatccatagacgaagctcttctccgagcttgctcttttcgcgcgtgatattcgtcttcggcttgcttcaacttcaagacatattgattccgtttgcctgtgaccaatcgaattttgtggatgtgcgcttcagtgtagtcgttggctgcatcatcctcaagctccttcttatactggttcagaatgtcgatcaaatcgttgacacctgcggcgcttgtgttgaatcccggcactgaagtgactctgaaacagcagacattaatttgtagcacgaaaacaaaaatcatcacttacctttgcatgtcatgtttgagacgttgcatgatccttgtgacgctctcattttgctcggcgatttcctcaataattggggtgtcatcggccattgttcgaagattatcctgataaaatataaaatttagaaaactgaagctaaattaagacgatttgtttgaaggttaaaaaggaattaaagaagcaataaatgcgaacgcagtttaaataagtaacgattggcggcgagagacgcagggaaatacgcagacgacat