Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:335-h8   

Cenix:335-h8RNAiCenix:335-h8
PCR_productcenix:335-h8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.5 Source_evidenceePCR614WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3A.5 Source_evidenceePCR956WS150 Sequence/Annotation Release
Chunk_score Abs_score873
Max_abs_score873Y47D3A.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1116885511170315
Overlaps_transcriptY47D3A.5 Source_evidenceePCR956WS150 Sequence/Annotation Release
WB_DNA_textTH:335-h81461tcgactacgtgaacactggcgagagtggtgagaatccaaatactgaagacaattgaagaaagaatgagcacgagaacattacagacacgaacctgcaaaaatttgagggtttttagggtctcgcagcgaaaatctaaagaaaatttgattttcccgccaaaatttaaaaatggcgcgaaactcaaatttgaaataattttttaaaaatttggcgctaaattcaagttcttcactaaaagattttcggtacttgtgtattacatgccctcattttcaaattaaattaaattgtcattaatttctccaattaaaataaacgtgatatacatttttcctctttaggcttagaaaatgttatttcctaagcctaaaaatacaaattgtggttcacgtttttatttttcatggcttaaaaaattactattaaaatgagggcatgtaatacacaagtaccagattttctcttcatatttcaatatttttcccaaaatttgatgataatattcgttgcgagacccaaacggaaaaaaaaaacaacaaacttacagtaagaaaatccggcggcgactttgtatcgccaacatcttcaaaaaggctatcacgaaccgagacttcatcgtcataattctgttctttcggtgattttttcgacgattttttaggcgttgcagcgatggtcgactcatcgggtgctacaattatttctgtattataataaaattaatttttctcaaatgatcaacctgaactttcttgcttttcaacagatgaaatcacaactttccctggagtcctcggagcaactggtgactcggtggtcggagtccgagttggcgtgtggggcggagttttggttggcggtgtcagtggcgaatttctgctcggagttctcggcagccgaaccgaacgaaattgcctgcgtgggcggtgttggtgcggcttcttcggagcaagtcttactccttttggacccaccgatggaggaggcggcggcagttgagacctcacatctgccagatcaacatatgtggcaccgcttttttgttgtttttctgcgggcgcaggcttcaattcggtgagattcacatattcttcgtccactgaaaggaaaacgtccattttgtgggcgtggcttgactaacttttaacacttttagttcacaataatttgcgaaacctaacaattgaattttagggtttcgtagcaagattctagagaaaatttgaatttcccccgcaaaacggggttgaccattttgtgggcggggcctaactggaaaagtaaactaaaaaagtagaaattagttagtacccaaattaacaaaactatatttttctaatgggcattgcctgcctgcacgtggtgtcaaagtgtcccattttaatttgatctacaaaaaatgcgggagacgagacgcagacctttcaactgatttcgcatggttaagggtgtgctgacgt