Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:34-a11   

Cenix:34-a11RNAiCenix:34-a11
PCR_productcenix:34-a11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST08G3.11 Source_evidenceePCR327WS150 Sequence/Annotation Release
Overlaps_Gene T08G3.11 Source_evidenceePCR327WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1648063216482153
Overlaps_transcriptT08G3.11 Source_evidenceePCR327WS150 Sequence/Annotation Release
WB_DNA_textTH:34-a111522gagttcgcgagaatgcctaccattttggcgagggaatattttgtagtgaagggacgcccgacatcacgcaagtctgtttttggcatatacataagttcaaagctgtaaaatttaggcagagagcgagaacgctttctaaaaaagttggttgaatatttttctgaaacccgttttccgttcaattgtgaatgtgaacaaaatttaacgtgctcgaaaaattttcaaaaaaaaagatttttgaaaagcataaaaacgtttttgaacagtaaatattgttttatcaacaaaatccttgacaagaacgcggtatttttgagttacacgtatttcaccaaaaattgtaacccattccgacccatttcacaggcctacccgcaacctccccgtctatttcttgtcttttttaacctacaaccagaataagttgaatccattcaacgcattaaactcacttgtttcttttgtttgtttttcagttctatgtgaaagtttgtaaaaaaaagtttgtaaaagtaataaataattaattggaagggaactagacacctgctgttgacttactccggttgtttggatagaaaatttttttcttggaacttgcattgagaaaataaatttgctgactttgcacttgcaatagattttttattttacttccaatgatttcgcaatccatcgggattgtgatatgtcaaaagcagcttctgcttcttgttttcgttgagatatttgtcagaaataaccttcagcttcaataggctcgctgggtccaagttttcatccagatacccactgtacatcggatcaaaaaacttgctttgcgcacgctcgatatcataccacgcgtgaagatcccaataaacctttctgatctgaaacgataagatatagaaataaattttaattgacctacattttcagaatcttctttattgaatattccttccgaaatagcagtcttgcatagatagtcaatctgatttttcttggccttgaagctatacaaatatttcttcatctcatctcgcacttctttcttgttcgtcggagaaccgtagtttctttcccaaaactccggttctatctggaaattatttacacatgtgtgattgcgatgatagttgtacccaatttttattcagccacttatcaaacgtagcaattgcaggtagagtccagttgtatttttccaagttctcaataatactgtattgcgaagaaatgttcgcaaacaagattaaattgcgagcaaaaatttgaagccgtggtcttgaaacaattccgatagttaaagtattacaaatcattagaaacaatagacatcgcatcgcgatgataacgagtgatgactacgtgtcattgttgcacactttttatacataaatccctcccacgccgcttgataatctgactattcggaggataaagatcgacaacttttgatgttcattgctgtgtagtttgatgcggaagttgttttacacactggcacgattagacaaaaatgatggatggggatcaa