Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:34-c8   

Cenix:34-c8RNAiCenix:34-c8
PCR_productcenix:34-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene Y54E5B.3 Source_evidenceePCR809WS150 Sequence/Annotation Release
Chunk_score Abs_score662
Max_abs_score662Y54E5B.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1482040714821733
Overlaps_transcript Y54E5B.3b Source_evidenceePCR809WS150 Sequence/Annotation Release
Y54E5B.3a Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textTH:34-c81327aatgcttcctggttttggtgcacaaacagtcagcccgttcccaaatcctccagagtacgcatcggcgtatacaagtgatcgaatcaataatggtaaggagtttgaattttgaaattttgaaactagcagtttttaattcagcaaacagtatttttttttgttagaaataaaacgcaatttctctaacagatttctcatacatcactttaacaagattcaggttcggcaccacctccgccgcatccacttacggaattcaaggtgtacggagaggaatatcgattggaagatgatgtcatcgcgtaagaaattttagcggctatataaaaaccaaaaacatgctgagtctagccgaattttcccacctattttgcaaaaacctttttcaatacgcgggaaaaactagaataaaacattcatttacagccctctgaaaaacgccggtgttgctgagctctacaagaacaaaaataattggaaaaccgagatgaagaagttgaacaggtccgccatagtcgcatttttcgatttggtcgaaattctgattcgcgctcccgatcacccaatgagagaggagaaaatggtcgatttacacacgatattcattaatatgcatcatttgatcaatgaattccggccagttcaggtagaaaagtgttttaaaaatgaaataaaatctatatttttctatgtttttcaggctcgcgacagtgttcgaattttacaagagagacaaatcgaagaattatcggatatttgcaaggattttaagttagtcaaatcggaattaagttttaaatttgtatattttttctccttttttccagaaaatatctgcgtgatggtcgagaagttgtcgatgaccaattccaaatgatccgtgggaagcttccagctccacctcaaccttcggaactgacacgtgtcaaactgcaagacggagtgcttcatatgcttcaggagacagaagcttcagatgacgtggaaatgaaagaggaagaaggatcggaatatagtaaaaagaaagcgaggctggaactattatcaagagaagatggaccaccgagtgttgtacacttgttagcaagacagtttcatgatatctcactgaagaaataattaaataatttcattttaatttattttaccgggttttcgaactatgattttgactctgatgatcttctgaaatgctgtaattaaaatttcgtttaaaaataacttttttcaatcgttttttcatctttgttctgttgaaaatgcgtcaattcgcattctttatttcgaattattttttatactttttaggcagctttcgtgtgacata