Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:34-f1   

Cenix:34-f1RNAiCenix:34-f1
PCR_productcenix:34-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF08G2.5 Source_evidenceePCR525WS150 Sequence/Annotation Release
Overlaps_Gene F08G2.5 Source_evidenceePCR525WS150 Sequence/Annotation Release
Chunk_score Abs_score504
Max_abs_score504F08G2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1383300613833782
Overlaps_transcriptF08G2.5 Source_evidenceePCR525WS150 Sequence/Annotation Release
WB_DNA_textTH:34-f1777cgaataagtttctctcggcgagttctcacaatcatagatcccgcgacgacgattgcggtatggttcccacgttccatttcttccatacggatgccatcgtctcccatgacgctgctcccactcggcaagcccatctcgacaacggcatggcgaggagtcactggaattggttgatgatttagaactcaccgagtcatcggaagaagaggacgaggaagaatcatcagagtcatcagaagagtcgtcagacgaagtgttcggaggtttcaccgactttctcttcgatctctgtttacgagctcgtcgagctcgtggagctggagattcagagatcggaagttccgaagaacgtggatattgacacccttgggtgtctctacgatcttgagaagttaacgtggaaaccgtggagtcggaatatctatcttcatcgtccttatctgaaagttcagattctgaactatcagatgacgagtcgaagaatccgtctccaagaggaagtggacgagtgctgagctttctcattgtaaatgagatgctcttcaaggtgagaggtgctggttttataggtgggttttgttgacgaatagtttcgaattatttcgaagagtttcgaaattagtcatgactttgataaggtgggcaaatattgatgacgatatgtgtgtagtattgccaaatttgaggagaactccttgccgtttgatctccgaaaattggggtcacacagaacatttctggaagtacatagaagtctatgtttcccgcaattttcag