Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-b11   

Cenix:340-b11RNAiCenix:340-b11
PCR_productcenix:340-b11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06H7.6 Source_evidenceePCR536WS150 Sequence/Annotation Release
Overlaps_Gene K06H7.6 Source_evidenceePCR536WS150 Sequence/Annotation Release
Chunk_score Abs_score473
Max_abs_score473K06H7.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80829028083527
Overlaps_transcriptK06H7.6 Source_evidenceePCR536WS150 Sequence/Annotation Release
WB_DNA_textTH:340-b11626cgatggagttgaagtagatcgaacaattccaaatatgtacgctcttctcctcttcttgttcctcgaaaaagaaacatggacaactgctgaagtagtcgagaaaatgggaatgtcagtggttgtgacaagaaaacgattggaatggctggttaaacaaggatttatttgcatggtaaaatagaaaattattaagttatcatataatttcattctcagaatcccattatcagtagcgacacgtggacattgacccggaatccaagtggaatttccatcgttcgaccaggcacaccggaccttgaagacgatgaagatgtggaaccggaagagaattctgatatggttgatgctttagaacaatattggggatatactagaaatttcattgtaagtaaaacttaaaatatataagaataaaaaaatcaattttcaggccaatcatgcacctaacggagaagtgaaagcggaacggatgcatcgtgtctaccgtatgttcggttctccaacttctgcaggacccactcttgatcatgtttccgcgtttttgcaaagaaaagttgcgctgggactgctaacctgcattaatgggtcatatcgtatcattcaggaaaagaaagacggcgaat