Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-f10   

Cenix:340-f10RNAiCenix:340-f10
PCR_productcenix:340-f10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C30C11.2 Source_evidenceePCR725WS150 Sequence/Annotation Release
Chunk_score Abs_score704
Max_abs_score704C30C11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII84478508448574
Overlaps_transcript C30C11.2.2 Source_evidenceePCR725WS150 Sequence/Annotation Release
C30C11.2.1 Source_evidenceePCR725WS150 Sequence/Annotation Release
WB_DNA_textTH:340-f10725acaactttgatcggcgtacactggatggactcgcagcaaaaaccctttatttcctctgtgtgatctacgaacgagaaggacgtcttttcgatcaccagggattcttgaactctcgactccgtactgcaactctccgtaatttctccgagtcacaagccgttctgatttgctggcttcttcgctgctacttgatcaaccgtcaatatcaatcagctgctcatcttgtctccaaagttgcattcccagacaatgcatctaacaatgatcttgcccgctacatgtactatcaaggacgtataaaggctcttcaactcgattacaattcggcggctggatatttcttgcaagctcagcgaaaagctccacaagaaggtgccattggcttcaaacaagctgttcagaagtgggttgttgtcattggtcttctacaaggagagattcctgatcgaagtgtgttccgtcaaccaatttatcgcaaatgtcttgctcactacctggatctcagtcgaggcgttcgcgatggagatgttgctcgttttaatcataatttggagcaattcaaaacacagtttgaagctgatgatactctcacattgattgttcgtctgcgtcaaaacgtcatcaagactgcaatcaagcaaatttctttggcgtattcccgaatttatatcaaggatattgccaagaagttgtatattactaacgagacagagactgaatacatt