Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-g6   

Cenix:340-g6RNAiCenix:340-g6
PCR_productcenix:340-g6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26G10.1 Source_evidenceePCR858WS150 Sequence/Annotation Release
Overlaps_Gene T26G10.1 Source_evidenceePCR858WS150 Sequence/Annotation Release
Chunk_score Abs_score837
Max_abs_score837T26G10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII94055439406400
Overlaps_transcriptT26G10.1 Source_evidenceePCR858WS150 Sequence/Annotation Release
WB_DNA_textTH:340-g6858tgtccatgaagagggacagcctgcattccaagttgacgaagcatcacagcaatctgcatggttgtagcacatgtggcacagaagacaattgcactatttccggcatgttcgtttagcagatacacaagatatgtttccttgtacttatttgggacgaagatgtagtgttgtttcagattatcgacagttttgtagcgactagaaacagaaacacgggccgggtctcgcaacgatgctcgttccaactttgaaactttcttggtcattgtggctgagaacaagtaggttcgacgttcacgaggaattactttaagaatcttatccagctccacctcaaaatccatattgagaatacgatcggcttcatccataattaagaatttcaatgctttcaaattgaatcctttggtattctctaaatgatcaaccaggcgtcctggagttgcaacgataatgtgaggtcttcttgcaagagccatcgcttgtgcagccatatccacaccaccgacgataaccgcagcaattaatccaattcctgagcccagagcttcaaattgttggccaatttggaatgcaagttctcttgttggagtcaatactaaacagaagaaagcttgaggatgatcgagaagtgattgtaagacgggaattgcaaatgcgccagtctttcctgatcctgtttctgcgagaccaattacatcttttccttgtagtgcgtgtggaagagcagcttgttgaatttttgacggtttcatccatccgagtcgctgacaagcatcacatagcggctgggagacaccaagttcggcaaatgatttctctttcacatcttcttcatcgtccttttcaatttcttcc