Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-g9   

Cenix:340-g9RNAiCenix:340-g9
PCR_productcenix:340-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F31E3.5 Source_evidenceePCR937WS150 Sequence/Annotation Release
Chunk_score Abs_score895
Max_abs_score895F31E3.5
Specificity_index0.82
Rel_score1
Map_statusUnique_ePCRIII69698646970942
R03G5.1 Chunk_score Abs_score197
Specificity_index0.18
Rel_score0.22
Overlaps_transcript F31E3.5.3 Source_evidenceePCR824WS150 Sequence/Annotation Release
F31E3.5.4 Source_evidenceePCR824WS150 Sequence/Annotation Release
F31E3.5.1 Source_evidenceePCR909WS150 Sequence/Annotation Release
F31E3.5.2 Source_evidenceePCR937WS150 Sequence/Annotation Release
WB_DNA_textTH:340-g91079aacgaggacacaatagccaaagtcttgattatttgcctcattatatctatcactttattaatgttaatgctgattttctggagttgagttaacagagatgaacgttgtttatcagttttcaatgtttatttatttcataacccattaaaaagtaaagagttgataatttattcaaaaatcaacaagataaactcaacaatgaagatttacttcttctttggtgcagccttttgggcggacttggtgacctttccagaggatccatcagacttctcaacggacttgataactccgacagcgacggtttgtctcatgtcacgaacggcgaaacgtccgagtggagcgtagtcggtgaaggattcaacacaaagtggcttggttgggatgagctcgacgattccagcatctccagacttgaggaactttgggaagtcctcaaccttcttaccggtacgacggtcaacctgaaaaacaaattggtacataaacgaaacaataagacaaataagttaccttctccttaagctcgttgaacttgcaggcgatgtgagcggtgtggcaatcgagaactggagtgtatccgttggagatctgtcctggatggttcatgatgatgacctgggcgtggaaggtgcgagcctccttggctgggtcttgcttggagtcggagcagacggatccacgacgaatatccttgacggagacgttcttgacgttgaatccaacgttgtctcctgggacggcctctggaagagattcgtgatgcatctcaacggacttgacttcagtggtgacgttttgtggagcgaaggtaacgaccattcctggcttgatgattccggtctcaacacgtccgactggaacagttccgattcctccgatcttgtacacatcctggagtgggagacggagtggtcggtcagttgggcgttgtggtggaatgatggagtcgagagcctcgaggagggtctttccggaagcgtttccttccttgcgctcaacggcccatcccttgaaccatggcatgttggaggagacctcaagcatgttgtctccgttgaatccagagattgggacga