Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:341-f11   

Cenix:341-f11RNAiCenix:341-f11
PCR_productcenix:341-f11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37D8A.10 Source_evidenceePCR453WS150 Sequence/Annotation Release
Overlaps_Gene Y37D8A.10 Source_evidenceePCR453WS150 Sequence/Annotation Release
Chunk_score Abs_score432
Max_abs_score432Y37D8A.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1287504512875497
Overlaps_transcriptY37D8A.10 Source_evidenceePCR453WS150 Sequence/Annotation Release
WB_DNA_textTH:341-f11453aacgacaaagtcggatggacggaatcgcataatctaatgaatctgcgtcttctcatctcattcatcggcgtcgcgttctccgcgttcgcctgcggctacgactactacgagccgttcccaaagtcgaaaatcgtgctcgccgtgtgctcggtttcctacttcatatgcatgggaattcttcaaatgtatcagtggtacgtcgagaaggactgcatctacgaggccaccgaagtcgacggaaaacaatcgagaaaatgggcgtggagctcggagatcaaggctcacgacgataagtacacgctgtcggccgagtttaagaaggaaggacgctctggacagggaaaaatcacgaaatctatcggagcttatatcgataacgatggagagatcatcgtgccacttgtgaagaaggaggtcgacgacttgtacaaccgcttgattcgtagcgaacaa