Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:342-b1   

Cenix:342-b1RNAiCenix:342-b1
PCR_productcenix:342-b1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53A2.4 Source_evidenceePCR544WS150 Sequence/Annotation Release
Overlaps_Gene F53A2.4 Source_evidenceePCR544WS150 Sequence/Annotation Release
Chunk_score Abs_score502
Max_abs_score502F53A2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1334104913341639
Overlaps_transcriptF53A2.4 Source_evidenceePCR544WS150 Sequence/Annotation Release
WB_DNA_textTH:342-b1591tctcaatatgagcgattcgactcggtgctgctctccatggcccaacagctgagcggcggagtgcctgaaatgcttgatgtactatttgaatttctttcgaggtaagaaattttttcaaagtgcttaataaatacatgttttgtttcagaaagacggatttctacagtggcgctggtgtcgatcaagcccggacccttctcctcgaaaaattcgataaacacggtggaaaggctatgaaggaagctgaagaagccaagaaacggaaggaagagcaggagaggaagcttgctgaacgaagagctgcacaaaaagctaaggaagaggaagagttccgaaatgcgaaagtcgtggaagtcactgatgaggaagcggccgcgtttgaaaaggaacaggctaaaaattctgttgaaaatcttgaaaaattcgtcgataacgaaggagaaacatcgaaagacgctgaagtcgaagatgaggacagtaagctcatgaaaccaaatagtggaaatggtgcggatcttgccaaatatcaatggactcaaacactccaagaactcgaggtgaagattccaattgctgctggatttgctatca