Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:35-b6   

Cenix:35-b6RNAiCenix:35-b6
PCR_productcenix:35-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC302.3 Source_evidenceePCR515WS150 Sequence/Annotation Release
Overlaps_Gene ZC302.3 Source_evidenceePCR515WS150 Sequence/Annotation Release
Chunk_score Abs_score450
Max_abs_score450ZC302.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1074215210743828
Overlaps_transcriptZC302.3 Source_evidenceePCR515WS150 Sequence/Annotation Release
WB_DNA_textTH:35-b61677ggagatcgagagtcgtttcgattcttaaaattctaagatttttagaataatttttcgacattcctaccgctttgtagtttagatactcagtttgtagagatacaacccgatccaaataaattagtgatcgttgttcataatgagaattggatgcggttttacgacaattccagtactctgaaaatagtgtttcttggttcaaaatgtttattatggagacgcagaaaaatgccccttttgaaatcgtgctccacggccacttcaataagttccgcccttgaaccattggtctcgttaggcattggcgggaaacccagaagttcaaacgttttcaattttttctctaatttcaagcgtttttcatcgttttgctatttttcccgttgtttctaatagtttttaggccgaaataatgttttaaagaaatgaaaatgcaaattgaaaaattgaaaaggtgaataaggtttttttgaaggaattatatttttcaccgttttgccattaaatacctaacgggatccatcattctgggggcagagcgttttcaattggctgtagagcgcgtttctatgaagaatggaagaagggttatctttgcgtccctataatataactcacgttgaaacatttgtttaatctctggaatatccatcaattccttctcgcttttccccaaaaatcttgcggcattcaacttgacagaatcttctactgatttagtaatcaacatatttttcaagacaacagtattaaccgtacattgtgatttcaatccatccagcattgacttgcttttttccaaagtttcatttgattttcttcgatattctctcattctagtagcattccacattttttgctcgtcctctgtcattatatgacctggtttttgccaaggaatctgagttgtcttcagatcatcaatcattgcaataaagtttcgatcgactggatgatgctataataattattttattttaaccaagatgacactgttctacaaaactacttctttttgtgtatttggtttaggatcagggagtggctgcatttgggcaaggagctcatgtgctctctgaaaaacattaatcattacattttcatgaagattcttcctctttttaaatattgattactctaaattttcacgttttgggaaatttggcaatttaccaaaactttgtctgcaacttttaaaacatctatgcatttttggagtatataattttgatatttagtatctagattctaaccacttcatacaacttgggcaattagtaatttcttcgccaactctagcaacttttggaataacgcatatctacaatggctaaagttggttgccaatgttaaggaattgctgaataagtaattaagtttaaccgcaaatttggattctgtcaaaagcatgtcaaaccctgttctatcgagcacaacatttatgctgacatttttttacaattttaatttttcgaatcgtaaaaatcttgaaaaatacttttgaattagcatagttttgcatgaaaccaaaagtcgttctgctatattttatgtctataatacggtaatctagtaaaaaacttacttctaatgacatatcaaagttcggagaatacaatggacgactaggtgggagtgaaatactaacaggaattgacgtcgggacatttctttctc