Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:35-f6   

Cenix:35-f6RNAiCenix:35-f6
PCR_productcenix:35-f6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF16H6.10 Source_evidenceePCR813WS150 Sequence/Annotation Release
Overlaps_Gene F16H6.10 Source_evidenceePCR1087WS150 Sequence/Annotation Release
Chunk_score Abs_score1003
Max_abs_score1003F16H6.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1822539518227023
Overlaps_transcriptF16H6.10 Source_evidenceePCR1087WS150 Sequence/Annotation Release
WB_DNA_textTH:35-f61629gtatttagctgacaccccgcaggtcagtttttttgtttttttggtttttagtgttttttggaaaaaaatctttttgtaattaaattacgtgtttgaacaattcaaacaaatcaccacaaatagaatagaatattggatgagattattaaagtttaagactaattctttttctgagtatttagaggagagtataaaaattttaagagttgttgttatccgataaatcctggagtcttttacaaactttccgagtgacgagtctgaaaattcatcaactaatagttttgcttaactaactgagttaccggaaagtcagataatgtagtgttagagctgaatgtatttttaacggtcacttggtcagctcccaaatttgatgattgacaacatttacctgtgacttcaaaactttcctgtattaagcttttgtcaattggctaaaattaggatcattataagattgaggtaaaaaagtaaacggagggcacttacatattcatcggagaacgccagaatatatgtgaataatttcgtcgtgccataaaaatcgtgaagttcaccattcactaaattttccagcattacaagttgatcatcagcataaacattttgtaatgaattatcgatgggtaatgtctgaaacagcagaaatatttgtgtgaaggtttgtgtggctgtaaatgggtatctcggtaatcgaaaacaaaatccgaaatcgaaaacctcgaaaacatgcacggttagatattttttttagttaattttctgaaagagcatagttgaaaacatttttcggtgcaattttaaaaaatttgagggtatagtttttcagaaaaattaaattttgtcaatatttttttattccgaatttttgaatttcacttggaattttgtaaaataagttatttgttacggatttttttaaatattaaaaacaacattacaaaataaacatttcaaactaggaatttcacaagttagaagtgaacaatttatttgaaacagctaatcaggttcttaagttacgccagttttggccgaaggtactctgaaaaaaaaagatgttctgaaaacttactttttcaaatacacacttgtcatgatcattcattgcattcaattttaatgtcttgaatatatcagaacgacagctgaccactaccgaaagtgcgtttggcattgatgaaatactccgtaaagttagtgtaaaatcgttcacgatcagagaagacggtctcaaatcaagaatccgtttgagatgtttcaaaaaggttacgtctgtcttattcaaactggattcctcactaattgtgattgaaagatgagaaagcacacgcattgatgacagaacactttctaaatcatctgagcacaactctatgtaattcttgtttttgataaactcctcttgtccatcatgcactcgctgacatccctctgggtgatttttgtagattactttgatcggggagagttttgtcgtactgaacaacaagaactcaaccgatacttgatcggcgtcttcctttgtgtcaatttcgacaattggagaatttttgagtcgtttcattagaaacttagataatgacatttttgtgaactaggaccaaccgactgcagattaaacgg