Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:36-c7   

Cenix:36-c7RNAiCenix:36-c7
PCR_productcenix:36-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26H10.1 Source_evidenceePCR534WS150 Sequence/Annotation Release
Overlaps_Gene T26H10.1 Source_evidenceePCR534WS150 Sequence/Annotation Release
Chunk_score Abs_score471
Max_abs_score471T26H10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1141946811420115
Overlaps_transcriptT26H10.1 Source_evidenceePCR534WS150 Sequence/Annotation Release
WB_DNA_textTH:36-c7648aattctgacgccaccgatacaacatcatcagctggtccaggtgttaatggaggaggaagaggagatgatgatggaaccggtggagctgaaggtgaaattgattcatctggaatacatttaaaacatgatatgatataagatactaaagcctacctggttgatgcgctgttggtgataaatgaataagtggatccgtgctcttgtcagaaataagagctaaaccactgttacctcgttgtgttgctcgtcgtgctccactgacccatttattccgaactgattctttaacacttgcaagttgcagtggacgaacttctaccaatggcgtcggcgcatcaaaagcttccatcatgtgctctttctcaacgtgtggaggcaacgatgtgcatgtgaaccatgcaagaactttggcaaatcttaaaatagaaaacaaaacattatgtagcaactcaacaaaaaaaaacttaggaagcattcacgtactttagtgctcttttggacattcgctcgccaagacttcctcgtttttgaatggcaattattacggatgagacaacggttcctagggaaatcactattatcattgctagaatgaaccatccaattagaggaataaatgtagatgttgtaggcatttgatcggagacc