Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:36-d4   

Cenix:36-d4RNAiCenix:36-d4
PCR_productcenix:36-d4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F52B11.3 Source_evidenceePCR531WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV1409502114095551
Overlaps_transcript F52B11.3.2 Source_evidenceePCR531WS150 Sequence/Annotation Release
F52B11.3.1 Source_evidenceePCR531WS150 Sequence/Annotation Release
WB_DNA_textTH:36-d4531cttcctgcttcatctacgccgtcggtcgccaggatgctaacatcaaggccaacccatcaatggactattacgagttcaactgtgaatcccaattcggaggaatggctctctgtaccaacgagggaatccgcttcatcgtcaacaccaaggagccatacaccggagccatctacgctgctgagagattctcgacatgctcccaagtcgtcgagaacgctaagcaaatctcgatcactttcccaccaccaactgtttcttccgattgtggaactgttattcgtgacggaaagatggaagctctcgttgttgtttctttggatggagtacttccacatcaagtcaccactgagtgggatcgtttctaccgtgtctcttgtgatgtttctatggataagatggtcaaggaaggatcagttgttgtcaccacaatctatgaggcttcttctcagaacacaacagtcttggatgttgctactccaccaccagtctctgctgaacttcagatccttaaccaacttgaggagccacttc