Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:37-e4   

Cenix:37-e4RNAiCenix:37-e4
PCR_productcenix:37-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C10C6.5 Source_evidenceePCR508WS150 Sequence/Annotation Release
Chunk_score Abs_score445
Max_abs_score445C10C6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1147151911472133
Overlaps_transcript (2)
WB_DNA_textTH:37-e4615acatttgcctgcgagctactctccaatccatcaattctattctgtgacgaaccaactactggtctcgactccttcatggccgaaagtgtagttcaagttctttcaaatctcgcaaaatcaggcagaactgtgatctgcacaattcatcaaccatcatcacaactttatctgatgttcgacagagtaatgttcatggctggtggaaaaacagcgtttttgggttctccaagagatgctattcaggtcataatcatcatttattaagttcaaaaatttattaaatttttcagtttttcgaagacgcaggtttcgcatgccctcgtaacttcaatcctgctgatttgattattcatactcttgcagtaatgccgaatgaagaagataaatgtcgtcagagaattgaagtgatttataccaaatttcagaataggtaagaatattatttcagatttaatatagattttattaaattttaaattgaaaatttcagttcctacggccgcaccttgaagtttggagttgagaagtcggatgaaggacaaagaccatcggaacgtcataaaactggtattctcacacaaatcggtgctcttctcgaaagatctgcaatcgaca