Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:38-e5   

Cenix:38-e5RNAiCenix:38-e5
PCR_productcenix:38-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y49A3A.2 Source_evidenceePCR515WS150 Sequence/Annotation Release
Chunk_score Abs_score494
Max_abs_score494Y49A3A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1435429114354812
Overlaps_transcript Y49A3A.2.3 Source_evidenceePCR513WS150 Sequence/Annotation Release
Y49A3A.2.2 Source_evidenceePCR513WS150 Sequence/Annotation Release
Y49A3A.2.1 Source_evidenceePCR515WS150 Sequence/Annotation Release
Y49A3A.2.4 Source_evidenceePCR507WS150 Sequence/Annotation Release
WB_DNA_textTH:38-e5522tcattccaggaaaagatggccgcagaatcttcgtacggattcgtttacggagtgtccggacctgtcgtcacagccgagaagatggctggatcggctatgtacgagttggttcgtgtaggacatcaagagctcgtcggagagattattcgtctcgagggtgactacgccactattcaagtatacgaggaaacatctggagtcacaatcggagatccagtacttcgtaccggtaaaccactttccgtcgaacttggaccaggtatcatgggatcgattttcgacggaattcagcgtccactcaaggatattgctgatattactcaatccatctacattccaaagggagtctccactaatgctctttctcgtgaagctcgctgggacttcgttgtgtccaaggatctccgtgttggaggacacgtgaccggaggtgacatcattggaaccgtcgatgagaacttgctcatcaagcacaagattcttctaccaccaagtgcatgcggaaccatcaccttcgttgct