Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:39-d7   

Cenix:39-d7RNAiCenix:39-d7
PCR_productcenix:39-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01B7.4 Source_evidenceePCR516WS150 Sequence/Annotation Release
Overlaps_Gene C01B7.4 Source_evidenceePCR516WS150 Sequence/Annotation Release
Chunk_score Abs_score495
Max_abs_score495C01B7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV87969518797466
Overlaps_transcriptC01B7.4 Source_evidenceePCR516WS150 Sequence/Annotation Release
WB_DNA_textTH:39-d7516gtaattggccccgaaagatttcgaaggatgtcacagatctcgttcacttgctttcctttcaatgaagatccattcaattcaagtagttcatcaccttcttggaataagttcatcttttctacaattcctcctttcacaactcttccgactattattttattattttcatttcgaaccgttgcgccaagataactatcctcatccttcacaacttcaactactttaacatttggagcatttcttggagatacagaagatgaagatgatgttgatgggcatctctctgattttccattcccattcattataactggtgggatgggggaagatgtacacgacgaagaatcaccgccagaatcggttccaattccagatgatgttgttccgcatttcccgttctgcttaactgtttgttcaatagcagcttgaattggtggagctgcgaagaaatctcgaagcattgcgacgtcactttcgcgcccttgcattgaagagagctttgatgcaattcgttca