Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:42-f8   

Cenix:42-f8RNAiCenix:42-f8
PCR_productcenix:42-f8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW06H3.3 Source_evidenceePCR537WS150 Sequence/Annotation Release
Overlaps_Gene W06H3.3 (3)
Overlaps_transcriptW06H3.3 Source_evidenceePCR537WS150 Sequence/Annotation Release
WB_DNA_textTH:42-f8537agcaacccgacgtttgtatcattgaactcggtggaactattggggatatagaaggaatgacatatctctcggcattcgaacgattccaacgtccaactcttaagaatgacttgatgaatgttcatgtttcgctgatattacatccaaacgccaccggtgaaccgaaaaccaagccaatgcagaactctgtccgccatttgcgggccgccggtcttgtgccggatcttctgatttgccgttcgactgagaagcttgatcctcacctcagagagaagattgccgggtttggaatgatggatttggagcaggtggttggtgttcatgatgtgtcgaatatatacaaggttccactgcttctccagcagcagggagtgttggaagcgattactcagcgtctcagattatcggaaatctctgagaatattagaaaagatttgaaattcaacatgaatcactggactaatctatcggagctctgtgatactttccagcaggttgtgaatattgcactcgtcggaaaatacgtgaaaatcgccg